Transcript asmbl_56890

Sequence
Transcript Sequence for observation asmbl_56890 of TGE0016775:
CCGCCGCTCTGCTGCAGCCGCAGCTGCAGCTCTGCAGAGCAAGGCTGGGGGCTGGGGCCGGGGCGCCCTCCCTCCCACCTTTTCCCGCCGCTATGAGCCAGGGAAGTTCGGGGGACTGGGCCCCACTCGAGCCCACCTCCGGACCCCCAGCGCCCCCCAATCCCTTCGTACATGAGTTACGTCTCTCCCGCCTCCAGAGGGTTAAGTTCTGCCTCCTGGGGGCACTGCTGGCCCCCATCCGAGTGCTTCTGGCCTTTATCGTCCTCTTTCTCCTCTGGCCCTTTGCCTGGCTGCAAGTAGCTGGTCTTACTGAGGAGCAGCTTCAGGAGCCACTTACGGGATGGAGAAAGACCGTGTGCCACAATGGGGTGCTGGGCCTCAGCCGCGTGCTCTTTTTCCTGCTGGGCTTCCTCCGGATTCGTGTTCGAGGCCAGCGCGCCTCTCGCCTTCAAGCCCCTGTCCTTGTTGCGGCCCCCCACTCTACTTTCTTTGACCCCATTGTTCTGCTTCCCTGTGACCTGCCCAAGGTCGTGTCCCGAGCTGAGAACCTTTCTGTGCCTGTCATTGGAGCCCTTCTTCGCTTCAACCAAGCCATCCTCGTATCCCGCCATGACCCAGCTTCTCGGCGCAGAGTGGTGGAGGAGGTCCGAAGGCGGGCTACCTCAGGAGGCAAGTGGCCCCAGGTACTGTTCTTTCCTGAAGGCACCTGTTCCAACAAGAAGGCTTTGCTTAAATTCAAACCAGGAGCCTTCATCGCAGGAGTCCCTGTGCAGCCTGTCCTCATCCGCTACCCCAACAGTCTGGACACCACCAGCTGGGCATGGAGGGGCCCTGGAGTACTCAAAGTCCTCTGGCTCACAGCCTCTCAGCCCTGCAGCATTGTGGATGTGGAGTTCCTCCCTGTGTACCACCCCAGCCCAGAAGAGAGCAGGGACCCCACCCTGTATGCCAACAATGTCCAGAGGGTTATGGCACAGGCCCTGGGCATTCCAGCCACTGAGTGTGAGTTTGTAGGGAGCTTGCCTGTGATTGTGGTGGGTCGGCTAAAGGTAGCATTGGAGCCACAGCTCTGGGAACTGGGAAAAGTACTTCGCAATGCTGGGCTGTCCCCTGGCTATGTGGACGCTGGGGCAGAGCCAGCCCGGAACCGAATGATCAGCCAGGAAGAGTTTGCCAGGCAGCTGCAGCTCTCTGACCCACAGACCGTAGCTGGTGCCTTTAACTACTTCCAGAAGGATGCCAGCGGTTTGGTGGACTTCCGAGATGTGGCCCTTGCACTGGCAGCTCTGGATGGGAGCAGGGACCTTGAGGAGCTGACTCTCCTGGCCTTTGAGGTACCAGGGGATTGGGAGTGGAGGGGACATCATAGCTGTGCTCACCCCACCCAGAAGCCTGTGTGGTGTGGCGCACTGTTATCAGTAGCTTCTAGATAGTAGGTGCTTGGTATCCACCCCAGTGCCACACTGTAAACTGCAGAGCCCCAGCGTCTCTATGTTGAGGCATAGCTGGGAACAGGAAGAGGACAGCAGTTATGAAGTTAGAATTCTCCTGCAGAAAGGACCCAGGGGCATAGGGAGGGCCTGTGCTCTGCATTCTTGGAAGAGGTGGAGCCTGTCAGGCAGACCTCCCGGGTAGTGTGGGGCAATGGCATGAGGGGGAGGGCTTGCCTGGTGTCCCTTCTCTCCCAGCTCTTCGCCGAGGAGCAAGCAGAGGGACCTGGCCGCCTGCTGTATAGAGACGGCTTCAGCACCATCCTGCACCTGCTGCTTGGGTCACCCCGCCCAGCTGCTGCGACTTTGCATGCTGAGCTGTGCCAGGCGGGATCCGACCAAGGCCTCTCCCTCTGTCAGTTCCAGGACTTCTCCCTCCGTGACCCACTCCACGGGAAGCTCTTCAGCACCTACCTGCGCCCCTCCCAGACACCAAATGCCTCATCCCCAGGCAGCCCCACTGCTCTGGCCAATGGGACTGTGCACGTGCCCAAGCAGAAGGGCGACTGAGCGCCTCCACCTCCCCAGCTCGCATCCAGCCCACAGACTCAGGGCAGCGCCAGGGGCTGACCCTGGGCCTCACGCCCTCTCTGCTCCTGCTTGATTTTTTGTTATTGTTGTTTGTTTTATTAAGTTTGTTTTATTAAGTTGATTTTCACTTTTTGTTTGATTTTTTGTAAG