Transcript asmbl_56816

Sequence
Transcript Sequence for observation asmbl_56816 of TGE0006414:
AGCCGACGTCGCCTCCTGCGCTGGGCTCAGCCTCGCTTCTAATTGGCCACCTTCGGGGCCGCCCTCCTGCGCGCACCAGCCCTGGGTTCCCTCCGCGGTCCGCACTGGTAAAGCTATCCTCTTCCTTCTTGACCCCTGGCGGTTCCTCCCTCCCTTCCTTCCCTCCCGCTGCCGCCGTCGCTTCTGGCACCACTGCTCCCGGAGGAGCCTTCCGGCTGGGTGATGGGGTCTCGGGCCTCCACGTTACTGCGGGATGAAGAGCTCGAAGAGATCAAGAAGGAGACTGGCTTTTCCCACAGTCAGATCACCCGCCTCTACAGCCGGTTCACTAGCCTGGACAAAGGAGAGAACGGGACTCTCAGCCGGGAAGATTTCCAGCGGATTCCAGAACTTGCTATCAACCCATTGGGGGATCGGATCATCAATGCCTTCTTTCCAGAGGGAGAGGACCAGGTAAACTTCCGTGGATTCATGAGAACTCTGGCTCATTTTCGGCCCATTGAGGATAATGAAAAGAGTAAAGATGTGAATGGACCAGAACCACTCAACAGTCGAAGCAACAAACTACACTTTGCTTTTCGACTATATGATTTGGATAAAGACGACAAGATTTCCCGTGATGAGCTGTTACAGGTCCTACGCATGATGGTCGGAGTGAATATCTCAGATGAACAGCTGGGCAGTATTGCAGACAGGACCATCCAGGAGGCTGATCAGGATGGAGACAGTGCCATATCTTTTACAGAATTTGTTAAGGTTTTGGAGAAGGTGGACGTAGAACAGAAAATGAGCATCCGGTTTCTTCACTAAAGGACTGAGATCAAACTGTTTCGTGCTTTCTAGTATTTAAGAACTGGAACCTGAGAATCCTCCTGTCCACCAACCCCACCTCCATTCCATCATTCCCCTTCTCCCTAAGTACCAAGGCTGTTGCATGATAACTCAGATATGTTCTATCAACACAAACCTGCCTTTGGTGTATAAACAGGGCATTATAGAATGGTACACCTGGTCTATATCTGTTCAGTATCATTCACTGGTTATCTCCATTTCTAAATATTCCTAACCCTTCCCCCACCCCGGTTCTGCTACTGAATGCCTCATGTCCATCTAGTCTGAGAAAGTGAGAGAAGGAATTATGCCAAGAACTAACCAGCAAAGCTCTTTCACTGGATGTAGACTATAGCCATGCCACCGTCCCTCCAGCTAGGCTTTGGCATGCTCCTCCATCCTTTTTTGTATGTCCTTTGCTTCCTACTTCTCTTTCACCCAATACACCATTCACTTAGTCTTTGTCTCTCTGCTTTTTATTAAGCTTCAGCCCCCTCTGTTCTATTTGGCACTCCAAGCTATGCCTGTTCAATGAATTTCTGACTTGGCAGGATAGTTTGGTGGTCTGAAGGATTTTAATCTACTGTTACTCTTGAATGGTCTCTGGGATGTTGCCTTTCCAGGAGCTTTTCGATAACAACACTGCTCTCAGAAGAATGAGACCATCTCTTGGTCCCTTGCACTCTGCTGTGTCATCAAAAGGCCGTGGGCTAGAGATGTTCTTCTTGAAAGGTGGTGGCCTTGTTGAGAGATGTAGAGCCAAGTCTTTTCGGTGGCTTGCCCAGATCGCTCTACCTCTGGCTTCTGATTCTCAACATACATACCTACATGGCTACTTTTAATAGTACAGTGTTGTTTTTTCAGAAAATAGCCACATGCTGGCAGGTTGGCTTAGTTTGGGGACACCAATACCACCAGAATGGCTGCCCTGACAGTATGCTTGGGGACTTTCTCGTGGCTTTTTGAACAAGAAGGCTGGGCACCCTAAAAGCCTCACGTATTCCCACCTCTGCAGCATGGTTTATACCTCAGTGTTATGTGCCCTGGAATGTTTCTCACTTCACATTTCTAGGTAGAAAGATTAGTGTTATGGAAGTGCCTAACTATCCCAGTCCAAAAGATTTAAAGATTGTCCTCAGTGTCTTGAAGTTTTGTACAAAATTCTCTATGAATTTTACATTTGGCAAATGTTAATGCTGGAAGCCATAGTCAGCCCTTAATACAGGTCCAAAGCATTGAATGTATTGTATCATTAGCTGCCTAGTTACACTGACTTCCTAGCTCCTCTCAGACCACTGCTAATCCCTTAGAAACGAGGGGTCTGGCATTGGTAGCATAACCTGAGGTGGCATTACAGGCCTTTGCACGAGCCAGAGCAACTTCTCTGCCTAAGTCAGCTAAATGTAGACCTCATTGAATCAGGCTGTTGTCCTAATGTTGGTCATTTATGAGTCTGTTCATTCTTATATCTGCCCTTAGCTGATTTTCTGACTCATTGCTTGCTGGCTTGTTTCCTTGCTTTGGAAGGCTATCCAAGATGTATACACAATACTTTCAGAAGGGAACTGCTAAAACAAAAAACACCACAAAGGGATTGGAAAGAGGGGAACAGAGCAGTAGTCAGGCTAGATAACTTAAGTATAAATGACTGAGGAATTCTTGATGAAGTATCAGTCTGACTTTGTGATCAAATGATATAATATAGGAATTGTGTAAAGGGAAGAATAATCTGACATTGATTTGTTAGAGAAGTACTTCAAAGGCTCCTTGACTTGCATATTTAAAATTCCTAAGATTATGGCTTTTTCTTCCCTTTGGCTGTATAGCAAACTGTTTTAATCCACAGTTGTGCCTTATCGTTCCATTAAAACTGTATTCTATCCATCAATAAACACTTGTGGTTAAAACAATA