Transcript asmbl_56740

Sequence
Transcript Sequence for observation asmbl_56740 of TGE0006406:
CTAAAAGTGTAAAGTCCCTTTTCTAACCTGGTGCAGCATCGTCCGCTAGGAGACGGGTGACGGCCCCCGCCCGCAGAGTTCTGATTGGCTGTGCACGCGTGGAATATAAGCCCAGACGCGCGGCCAGGAGTGCAGTAGGACGCTCGGAGCTGCTCTGGTAGCGATGGCTCTCCCCGTGACCTTGGCCCTGTTCGCGCTGCTTTTCCTTTCTGGCCTAGACGGCGAGCCGCGTACTCCAAAGATTCAGGTTTACTCACGGCATCCAGCAGAGAATGGAAAGCCAAATTACCTGAACTGCTATGTCTATGGATTCCACCCACCTCAGATTGAAATTGATTTGCTGAAGAATGGACAGAAGATGAAAACGGAGCAGTCAGACTTGTCTTTCAGCAAGGACTGGTCGTTCTATCTTCTGGTCCACACAGATTTCACTCCCAGTACAGTGGATGAGTACAGCTGCCGTGTGAATCACAGCAGTCTCGCTGCGCCCCATATGGTTAAGTGGGATCGAAACAACTAACCAGCATCATGGAGGTTTGAAGATGCCTCATTTAAATTGGACTAATTCCAAATTGTTTCTTCTTTTTTTTTTAAATACTTATATGCTAGTATGCTTTATGTACACAAATTGAGAAGATATATTGATGTTAACATAAATACCTTTATAATTCTACTTTGGGCTCTATGTCTTCATATTTGATGCATGTGGGTAGGTAGCTGTAGCAGGTTGCTAGAAGTTTAGAGGTGGGAAGGAGGGAATTCTCATGTTCAATATCATCATCTTGGTCTAATCTGAACTCTTTAGTATTCTGCATACAAAATTGGATAAGATCATTGTGCATGTTTAGAGTTAAGCTCCAGTTTGCATACTTTGCTTAGAATTTTTGGAAATAGTTTTTAAAAGAAAATTGTCAATTATTGGAAAATCATTATAGTGGATTGAAAGAATTTTCATATAAAATTCACATTTACCTCATATTTGTGTGGCACATATGTTGCAGGCGAGAATTCTGTCAGAGAACCACCAGTACGCCAGTTGTATTGCACATATTTTGATATTTTTGCTTCACTGATTAAAATAATGGTAAACTTGA