Transcript asmbl_56722

Sequence
Transcript Sequence for observation asmbl_56722 of TGE0006402:
CCGGAAGAAAGGACTCCTGCTGCAGATGTCTTGTGATTACCTCGGAAGCCTTACTTCGCCAGTTGAAACTGCAGAAGAAAATAGGATCTAGCGAAATATGGCTACGGAGGGCCCTGCCACGTGTCGAATCCAGGTGGCAGAACATCCCAGATTGCTAAAGCTAAAAGAGACATTTAACTCTAAGTTTGGATCCATTCCCAAGTTTTATGTTCGAGCACCAGGAAGAGTCAACATAATAGGAGAACATATAGATTACTGTGGATATTCTGTTCTTCCTATGGCTGTGGAACAAGATATGTTAATAGCTGTGGAACCTGTGAAAACACACACTCTTCAACTGGCCAATACAAATCCCTTGTACCCAGATTTCAGTACTAGTGCTAATAACATTCAGATTGACAAAACCAAGCCTCTGTGGCACAACTATTTCCTATGTGGATTTAAAGGAATTCAGGAACACTTTGGTCTTAGTAACCTGACTGGAATGAATTGCTTGGTGGATGGAACCATCCCACCAAGTTCTGGCCTCTCCAGCTCCAGTGCTTTGGTCTGTTGTGCTGGCTTGGTGACGCTCACAGTTTTGGGAATGAACCTATCCAAGGTGGAACTTGCAGAAATCTGCGCCAAGAGTGAGCGTTATATTGGCACCGAAGGAGGAGGGATGGACCAGTCCATATCATTTCTTGCAGAAGAAGGAACGGCCAAGTTGATAGAATTTAGTCCTCTGAGGGCAACGGATGTGAAACTCCCAAGTGAAGCAGTGTTTGTGATTGCCAACAGTTGTGTGGAAATGAATAAGGCAGCAACTTCCCATTTCAACATCAGGGTGATGGAGTGCCGGCTGGCTGCAAAGCTCCTGGCTAAGTACAAAAGCTTGCAATGGGATAAAGTACTGCGGCTGGAGGAGGTACAGGCCAAACTAGGGGTCAGCCTGGAAGAAATGCTGTTAATCACAGAGGATGCTCTTCACCCTGAACCCTATAGCCCCGAAGAGGTCTGCAAGTGTCTGGGAATTAGCCTGCAGGAACTCCGGACCCAAATCCTGAGTCCGAACACACAAGATGTGCTCATCTTCAAACTCTACCAGCGGGCAAAGCACGTGTACAGTGAGGCTGCGCGAGTACTCCAATTTAAGAGGATATGTGAAGAGGCACCTGGCAACATGGTCCAGCTGCTGGGGGAGCTAATGAACCAGAGCCATGTGAGCTGCCGGGACATGTACGAGTGTAGCTGCCCTGAGCTGGACCAGCTG