Transcript asmbl_56618

Sequence
Transcript Sequence for observation asmbl_56618 of TGE0006378:
GCCCGTTTGAAATGCGCCAGGCGCGAGCTCACCTGGGCTCGCAGCCGTGCGGCGGGGCTTGACGGAGCAAAGCGTCTCAGCCGTAGCTTCCAGTTTCGTGCGGCTCGTTTCTGCGACCCGCTGTCCTCGCCAGCCCTTCCAGCGAGCTTGGCGTCCCGCGCGCGCGTCTAGGCATCACGGAGCCTGCTGCCATGAAGCCAGCGAGGACTAAGACACCCAGGAAACCTGTAGTGAAAAAAGGATCCCAAACAAGTCTTAAAGACCCAGTTGGGGTATACTGTAGGGTGCGCCCACTGAGCTTTCCTGATCACGAGTGTTGCATAGAAGTGATCAATAATACAACTGTTCAGCTTCATACTCCTGAGGGTTACAGACTCAACCGAAATGGAGACTATAAGGAGACTCAGTATTCATTTAAACAAGTATTTGGCACTCATACTACCCAGAAGGAGCTCTTCGATGTTGTGGCTAATCCCTTGGTAGATGACCTTATTCATGGCAAGAATGGTCTCCTTTTTACATATGGTGTGACGGGAAGTGGGAAAACTCACACCATGACTGGTTCTCCAGGGGAAGGAGGGCTACTTCCTCGTTGTTTGGGCATGATCTTTAACAGTATCGGGTCATTTCAAGCTAAACGATATGTTTTTAAGTGTAATGATAGGAATAGCATGGATATACAGTGTGAAGTTGATGCCTTATTAGAACGGCAGAAAAGAGAAGCCATGCCGCATCCAAAGACCCCTGCTATCAAACGACAAGCAGACCCAGAGTTTGCAGATATGATAAATTTACAAGAATTTTGCAAAGCAGAAGAGGTTGATGAAGATAGTGTCTATGGTGTATTTGTCTCTTATATTGAAATATATAATAATTACATATATGATCTATTGGAAGAAGTTTCGTTTGATCCCATAAAGCCAAAGTGGAACAGTTGCAGCACGCCCATGAGGAACACAGACTTTGTACCTCCGCAATCTAAATTGCTTCGTGAAGATAAGAACCATAACATGTATGTTGCAGGATGTACAGAAGTAGAAGTAAAATCTGTTGAGGAGGCTTTTGAAGTTTTCTGGAGAGGCCAGAAAAAGAGACGTATTGCTAACACACATTTGAATCGTGAGTCTAGCCGTTCTCATAGCGTGTTCAACATTAAATTAGTTCAAGCTCCACTGGATGCAGATGGGGATAATGTCTTACAGGAAAAAGAACAAATCACTATAAGCCAATTGTCCTTGGTAGATCTTGCTGGAAGTGAAAGAACTAACCGGACAAAAGCAGAAGGGAACAGATTACGTGAAGCTGGTAACATTAACCAGTCACTAATGACACTAAGAACATGTATGGAAGTCCTGAGAGAGAACCAAATGTATGGAACTAACAAGATGGTTCCATATCGCGATTCAAAGTTAACTCATCTATTTAAGAACTACTTTGATGGAGAAGGAAAAGTACGCATGATTGTGTGTGTGAATCCAAAGGCCGAAGATTATGAAGAAAGCTTGCAAGTCATGAGATTTGCGGAAGTGACCCAAGAAGTTGAAGTAGCAAGACCTGTAGACAAGGCAATATGTGGTTTAACGCCTGGACGGCGATTCAGGAATCATGCTCGGGCAGGTCCAGTTGAACTACTGGTTACAGAAGTGGTTTTACAGAGTTTTCCACCTTTGCCATCCTGTGAAATTTTGGATATCAATGATGAGCAGACTCTCCCGAGGCTGATTGAAGCTTTAGAGAAACGCCATCAACTACGACAAATGATGACTGATGAGTTTAACAAACAATCTGTTACTTTTAAAGCTATGTTGCAAGAATTTGACAATGGTGTTTTAAATAAAGAAAACTACATTCAAGGAAAACTAAATGAAAAAGAAAAGGTGATCTCAGGACAGAAATTGGAAATAGAACGACTGGAGAAGAAAAACAAAACTTTAGAATATAAGATTGAAATTTTAGAGAAAACAACTACTATCTATGAAGAAGATAAGCGCAATCTGCAGCAGGAACTTGAAACCCAGAATCAGAAACTTCAGCGACAGTTTTCTGACAAACGCAGACTAGAAGCCAGGTTACAAGGCATGGTGACAGAAACAACAATGAAATGGGAGAAAGAATGCGAGCGTCGAGTGGCAGCTAAACAGCTGGAGATGCAAAATAAACTCTGGGTGAAAGATGAAAAACTGAAACAACTAAAGGCTATTGTTACTGAACCCAAAACTGAAAAGCCAGAGAGACCCTCTCGGGCACGAGATCAAGAAAAAGCTCCTCAAAGATCTGTTTCTCCATCGCCAGTACCCCTTTCTAGTAACTATATTGCTCAGATTTCCAACGGCCAGCAACTCATGAGCCAGCCACAACTACATAGGCGCTCTAACTCTTGCAGCAGCATTTCTGTAGCTTCCTGTATTTCGGAGTGGGAGCAGAAAATTCCTCCGTACAACACACCTCTCAATGTCACATCCATTGCAAGGCGTAGGCAGCAGGAGCCAGGACAAAGTAAAACTTGTATCGTGTCAGACAGAAGGCGAGGGATGTACTGGACTGAAGGCAGGGAGGTGGTTCCTACATTCAGAAATGAGATAGAAATAGAAGAGGATCATTGCTGCAGGAATGTACCACCACTTCGTCTCCGACACAGACGATCACGCTCTGCAGGAGACAGATGGGTAGATCATAAGCCTGCCTCTAACGTGCAAACTGAAACAGTCATGCAGCCACATGTCCCTCATGCCATCACAGTATCTGTTGCAAATGAAAAGGCACTAGCTAAGTGTGAGAAGTACATGCTGACCCACCAGGAACTAGCCTCCGATGGGGAGATTGAAACTAAACTAATTAAGGGTGACGTTTATAAAACAAGGGGTGGTGGACAATCTGTTCAGTTTACTGATATTGAGACTTTGAAGCAAGAATCACCAACTGGTCGAAAACGGAGATCTTCCACAGTAACACCTGCCCAACCAGATGGTGCAGAGTCTGAATGGACCGATGTAGAAACAAGGTGTTCTGTGGCTGTAGAGATGAGAGCAGGGTCTCAACTGGGTCCTGGATATCAGCATCACGCACAACCCAAGCGCAAGAAGCCATGAACTGACAGTCTAATTAATGAAAGAACATTTTGTGTCAGTAATTTCTTCAAGACCATGCCAGAAGGAGTCTTCTGAGTCATCTTGTAGAAGTCCAACTTTGACTATCACAGACCTCAGATACATCATACACTGGCCTAGATCAGAGATTTCTGTCTGGTTCCAAAGACATCTAGGATTCAACAAACTTTTTATATCCCTTGCCATATTTAATATTAATAGAGAAAGACCCCCCTTTTCTCATTGCTGCATGAACTTTTTAATAATGCTATTTTTGTATATTTGTATACTTATAAACTAATTCATGCAAGTGTTTGTCTTGGGTGATTAAGGAAGAATATATCTAGATCACGCTTTATTTTTTATTGTGACTTTTCCAGCTCTTGTCTGAATATTAAGGTTTTATAAACAAAACAAATGCTGCTATTGATTAGCTGCAAGAATGCACTTTAGACATATTTGACAATTCAAACTTTCAAAATAAAGATGTCAATGACTGGCCAATACTAAAACCATTTTAAGAAGTCGTTTTGAATTTTGTATGTATATATTCACTTTCTGACACTTAGATATACCAAAAGAATTGAAATAAAAAGCACTAAGAAATA