Transcript asmbl_56587

Sequence
Transcript Sequence for observation asmbl_56587 of TGE0006374:
GGTTTTATAGGATCACATTAACAAAAACATGATGGAGTTTTATGAGTCAACATATTTTATTGTCCTTATTCCTTCAGTAGTGATTACAGTAATTTTCCTCTTCTTCTGGCTTTTCATGAAAGAAACATTATATGATGAGGTTCTTGCAAAACAGAAAAGAGAACAAAAGCTTATTCCTACCAAAACAGATAAAAAGAAGGCAGAAAAGAAAAAGAATAAAAAGAAAGAAATCCAGAATGGTAACCTCCATGAATCTGATTCTGAGAATGTACCCCGGGAATTTAAATTATCTGATGCATTGGCTGTAGAAGATGAGCAAGTTGTACCTGTTCCACTGAATGTGGTTGATACTTCAAGTAGTGTTAGAGAAAGAAAGAAGAAGGAAAAGAAACACAAGCCTGTACTAGAAGAGCAGGTCACCAAAGAAAGTGATGTATCAAAGATTCCAGGCAAAAAAGTAGAACCTGTCCCAGTTACTAAACAGCCTACCCCGCCGTCAGAAGCAGCTGCCTCAAAGAAGAAACCAGGGCAGAAGAAGTCTAAAAATGGAAACGATGATCAGGATAAAAAGGTGGAAACTCTTATGGCACCTTCAAGAAAGCAAGAATCATTACCCCTCCACCAAGAGACTAAACAAGAAAGTGGATCAGGAAAGAAGAAAGTTTCATCAAAGAAGCAAAAGACAGAAAATGTCTTGGTAGACGAACCCCTTATTCATGCAACTACTTACATTCCTTTGATGGATAATGCTGACTCAAATCCCGTGGTGGATAAGAGAGAGGTTATTGATCTAATTAAATCTGACCAAGTAGAAGCAATTCAGAAAACAGGGGCTAAAAAACTGAAGACTGAAACTGACAAAGAAAATGCTGAGGTGAAATTTAAAGATTTTCTTCTGTCCTTGAAGACTATGATGTTTTCTGAAGATGAGGCCCTTTGTGTTGTAGACCTGCTAAAAGAGAAGTCTGGTGTGATACAGGATGCTTTAAAGAAGTCAAGTAAAGGAGAATTGACTGCACTTTTACATCAGCTTCAAGAAAAAGACAAATTACTTGCTGCTCTGAAGGAAGACGGCACTGCTATGAAGGATCGGTGTAAGCAGCTAACCCAGGAAATGATGACAGAGAAAGAAAGAAGCAATGTGGTTATAGCAAGGATGAAAGATCGGATTGGTGCATTAGAAAAGGAACATAATGTATTTCAAAACAAAATTCATGTCAGTTATCAAGAGACTCAACAGATGCAGATGAAGTTCCAGCAAGTTCGTGAGCAGATGGAGGCAGAGATAGCTCACTTGAAGCAAGAAAATGGCATACTGAGAGATGCTGTCAGCAACACTACAAACCAACTAGAAAACAAGCAGTCTGCTGAACTAAATAAACTGCGCCAGGATTATGCCAGATTGGTGAATGAGCTGACTGAGAAAACAGGAAAGCTACAGCAAGAGGAAGTCCAAAAGAAGAATGCTGAGCAAGCAGTTACTCAGTTGAAGGTTCAACTACAAGAAGCTGAGAGAAGGTGGGAAGAAGTCCAGAGCTATATCAGGAAGAGGACAGCAGAGCATGAGGCAGCACAGCAAGATTTACAGAGTAAATTTGTGGCCAAAGAAAATGAAGTACAGAGTCTGCATAGTAAGCTTACAGATACCTTGGTATCAAAACAACAGTTGGAACAAAGACTAATGCAGTTAATGGAATCGGAGCAAAAAAGGGTGAACAAAGAAGAGTCTCTACAAATGCAACTTCAGGATATTTTGGAGCAGAATGAGGCTTTGAAAGCTCAAATTCAGCAATTCCATTCCCAGATTGCAGCTCAGACCTCTGCTTCAGTTCTAGCAGAAGAATTACATAAAGTGATTGCAGAAAAGGATAAGCAGATAAAACAGACTGAAGATTCTTTAGCAAATGAACATGATCATTTAACAAGTAAAGAGGAGGAACTTAAGGATATACAGAATATGAATTTCTTATTAAAAGCTGAAGTGCAAAAATTACAGGCCCTGGCAAATGAACAGGCTGCTGCTGTACATGAACTGGAGAAGATGCAAAAAAGTATTCATGTTAAGGATGATAAAATAAGATTGCTTGAAGAGCAGCTACAGTGTGAAATTTCAGACAAAATGGAAGAATTTAAGATTCTAAATGACCAAAACAAAGCATTACAATTAGAAGTTCAGAAGCTACAGACTCTTATTTCTGAACAGCCTAATAAAGATGTTGTGGAACAAATGGAAAAATGCATTCAAGAAAAAGATGAGAAGTTGAAGACTGTGGAAGAATTGCTTGAAACTGGGCTTATTCAGGTGGCCACTAAAGAAGAAGAACTGAATGCAATAAGAACAGAAAATTCATCTCTGACGAAAGAAGTTCAAGACTTAAAGGCTAAGCAGAATGATCAGGTTTCTTTTGCATCTCTAGTTGAAGAACTTAAGAAAGTGATCCATGAAAAAGATGGAAAGATCAAGTCTGTGGAAGAGCTTCTGGAAGCTGAACTTCTCAAAGTTGCTAATAAGGAGAAGACTATTCAGGATTTGAAACAGGAAATAGAGGCTCTAAAAGAAGAAATAGGAAATATCCAGCTTGAAAAGGCTCAACAGTTATCTATCACTTCTCAAGTTCAGGAGCTTCAGAACTTGTTAAAAGGAAAGGAGGAACAGATAAATACCATGAAGACTGCTTTAGAAGAGAAGGAGAAAGATCTAACTAATAGAGGGAAATGGTTACAGGATCTTCAAGAAGAAAATGAATCTTTAAAAGATCATGTTCAGGAGATAGCACAACATAACTTGAAAGAGGCATGTTCTGCATCACGATTTGAAGAACTTGAGACTGTGTTGAAAGAAAAGGAAAATGAAATGAAGAGAGTAGAAACTATGCTGAAGGAGAGGGAGAGTGATCTTTCTAGCAAAACAAAGCAGTTACAGGAGGTACAAGATGAAAACAGATTGTTTAAATCCCAAATCGAGCAGCTTAAGCAACAGAACTACCAACAGGCATCTTCTTTTTCCCCTCATGAAGAACTATTGAAAGTAATTTCAGAAAGAGAGAAGGAAATAACTTGTCTCCAGAATGAGTTAGATTCTTTGAAGGATGCGGTTGAACACCAGAGGAAGAAAAATAATGACCTTCGGGAGAAAAACTGGGAAGCAATGGAAGCATTGGCATCAACTGAAAAAATGCTGCAGGAGAGAGTGAACAAGACTTCCAAGGAAAGACAACAACATGTGGAAACTGTTGAGTTGGAGGCTAAGGAAGTTCTCAAAAAATTATTTCCAAAGGTGTCTGTCCCTTCTAATTTGAGTTACAGCGAATGGTTACGTGGATTTGAAAAGAAGGCAAAAGAATGTGTGACTGAAACTTCAGGTTCAGAGGAGGTTAAGGTTCTAGAGCACAAATTAAAAGAAGCTGATGAAATGCACACATTGTTACAGCTGGAGTGTGAAAAATATAAGTCCGTCCTTGCAGAAACAGAAGGAATTTTACAGAAGCTACAGAGAAGTGTGGAACAAGAAGAAAATAAATGGAAAGTTAAGGTCGATGAATCACAAAAGACTATTAAACAGATGCAGTTGTCATTCACATCTTCGGAACAAGAGCTAGAGCGATTAAGAAAAGAAAATAAAGATATTGAAAATTTGAGACGAGAACGAGAGCATTTGGAAATGGAACTAGAGAAGGCAGAAATTGAACGATCTACCTATGTCACAGAAGTCAGAGAGCTGAAAGATCTGTTGACTGAATTGCAGAAAAAACTTGATGATTCATATTCTGAAGCAGTAAGACAGAATGAAGAGCTAAATTTGTTAAAAACACAATTAAATGAAACACTCACAAAACTTCGAACTGAACAAAGTGAAAGACAGAAGGTAGCTGGTGACTTGCATAAGGCTCAACAGTCACTGGATCTTATCCAGTCAAAAATAGTAAAAGCTGCTGGAGATACTACTGTTATTGAAAATAGTGATGTTTCCTCAGAAATGGAATCTTCTGAGAAGGAGACAATGTCTGTAAGTCTAAATCAGACTGTAACACAGTTACAGCAGTTGCTTCAGGCAGTAAACCAACAACTCACAAAAGAGAAAGAACACTACCAGGTCTTAGAGTGAAGTAATTGGGGAAACCATTCAAGGATAACAGGAGGCATTGTATTATATTTTGCCAAATTAAAGCCTTATTTATGTTTTCACCCTTTCTACTTCGTCAGAAACACTGAACAGAGTTTTGTCTTTTCTAATCCTTGTTAGACTACTGATTTAAAGAGAGAGAAAAAAAGCCAACTCTGTAGACACCTTCAGAGTTTAGTTTTATAATAAAAACTGTTTGAATAATTAGACCTTTACATTCCTGAAGATAAAATAAACATGTACTCTTTTATCTTATTTTGCTCAATAAAATTGTTCAGAAGATCAAAAGTGGTAAAGACAATGTAAAATTTAACATTTTAATACTGATGTTCTACACTGTTTTACTTAACATTTTGGGGAGTAACTGCCTCTGACTTCAACTCAAGAAAACACTTTTTTGTTGCTAATGTAATCAGTTTTTG