Transcript asmbl_56584

Sequence
Transcript Sequence for observation asmbl_56584 of TGE0013536:
TCTAGATCATAGGCTTAGAAGCCTCTATATCCTGGATGGTTTACTTGGTTATATAATTGTTTCACATTTCAGATGCAGTTGTCATTCACATCTTCGGAACAAGAGCTAGAGCGATTAAGAAAAGAAAATAAAGATATTGAAAATTTGAGACGAGAACGAGAGCATTTGGAAATGGAACTAGAGAAGGCAGAAATTGAACGATCTACCTATGTCACAGAAGTCAGAGAGTTAAAAACACAATTAAATGAAACACTCACAAAACTTCGAACTGAACAAAGTGAAAGACAGAAGGTAGCTGGTGACTTGCATAAGGCTCAACAGTCACTGGATCTTATCCAGTCAAAAATAGTAAAAGCTGCTGGAGATACTACTGTTATTGAAAATAGTGATGTTTCCTCAGAAATGGAATCTTCTGAGAAGGAGACAATGTCTGTAAGTCTAAATCAGACTGTAACACAGTTACAGCAGTTGCTTCAGGCAGTAAACCAACAACTCACAAAAGAGAAAGAACACTACCAGGTCTTAGAGTGAAGTAATTGGGGAAACCATTCAAGGATAACAGGAGGCATTGTATTATATTTTGCCAAATTAAAGCCTTATTTATGTTTTCACCCTTTCTACTTCGTCAGAAACACTGAACAGAGTTTTGTCTTTTCTAATCCTTGTTAGACTACTGATTTAAAGAGAGAGAAAAAAAGCCAACTCTGTAGACACCTTCAGAGTTTAGTTTTATAATAAAAACTGTTTGAATAATTAGACCTTTACATTCCTGAAGATAAAATAAACATGTACTCTTTTATCTTATTTTGCTCAATAAAATTGTTCAGAAGATCAAAAGTGGTAAAGACAATGTAAAATTTAACATTTTAATACTGATGTTCTACACTGTTTTACTTAACATTTTGGGGAGTAACTGCCTCTGACTTCAACTCAAGAAAACACTTTTTTGTTGCTAATGTAATCAGTTTTTG