Transcript asmbl_5612

Sequence
Transcript Sequence for observation asmbl_5612 of TGE0016698:
GCAGTATTGTGCGTTCGCTTTGTTTTCCAAGCTGTACGCCCCTCTTCCTTGTTCCGTGTCTTACCTGATCTCCTCTTTGAAGGAAGATTCCTAAGCAGCCCGTTAAGCCCACTTTGGGATAAAGGATTTAGAGAAACCCAAGGCTGAAATTACCTTTTTTCCTCTTTCAGCCCTACCTCAGCACCTCACACCATGGCAGTTCCCGAGAGCCGCCCCAACCACACTATTTATATCAACAATCTCAATGAGAAGATCAAGAAGGATGAGCTGAAGAAATCCCTGTACGCCATCTTCTCCCAGTTTGGCCAGATCCTGGATATCCTGGTGTCACGGAGCCTGAAGATGAGGGGCCAGGCCTTTGTCATCTTCAAGGAAGTCAGCAGCGCCACCAATGCCTTGCGCTCCATGCAGGGATTCCCCTTCTACGATAAGCCTATGCGCATCCAGTACGCCAAGACTGACTCGGATATTATTGCCAAGATGAAAGGCACTTTTGTGGAGCGGGACCGCAAGCGAGAGAAGAGGAAGCCCAAGAGCCAGGAGACCCCAGCTGCCAAGAAGGCTGTGCAGGGCGGGGCTGCCG