Transcript asmbl_54595

Sequence
Transcript Sequence for observation asmbl_54595 of TGE0006294:
GGCTAAGGAAACTAACTAAAACCACGGCGTATTCGTCGGCCCCAGCCTGGCTCCCGGAAGCACACGGCGGGCTTTGCTCTAGCCTCAGCGAGAACGCCGGCCGCATCCCCCTGTCCGGAGTTGGATCCCGCCGCGCTTCCGGTGTGTTTTCCGGTCCGCCTCCCCAGGCAGGAAGTGCCGGGCGCGGCCTCTGTCGCGCCTCAGTCCATCGCTCATCGCAGTCGCTCGTCGTCTCGTGCAGGGCACCGCGGGTTCTGGTGTTGGCGACGAATTAAACAGCCACCATGTCAAGCAAAAAGGCAAAGACCAAGACCACCAAGAAGCGCCCCCAGCGTGCAACATCCAATGTGTTCGCCATGTTTGACCAGTCACAAATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAATAGAGATGGCTTCATTGACAAGGAGGATTTGCATGATATGCTTGCTTCTCTAGGGAAGAATCCAACGGACGCATACCTCGACGCCATGATGAATGAGGCTCCAGGGCCTATAAATTTCACCATGTTCCTCACGATGTTTGGTGAAAAGTTAAATGGCACAGATCCAGAAGATGTCATCAGAAATGCTTTTGCTTGCTTTGATGAAGAAGCAACTGGCACCATTCAGGAAGATTACCTGAGAGAGCTGCTGACGACAATGGGAGATCGGTTTACGGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGACAAAAAGGGAAATTTCAATTACATTGAGTTCACGCGCATCCTTAAACATGGAGCAAAAGATAAAGATGATTGAAAGAACTTTAGCTAAAACCTTTCGATTTCTTTGTCTTACTCTGTTTTATTTCCCCAGCACTTTCCCCAACATTTATCGACCTGTTGCATGCAACTTAGTTTCACAGCTTTGCCTCTTTTTTTTGATGTATTTATTCTAGACCTTTCTGCCAATTAGCACTTGTATAATCAGACTACAGATGGGGATGAGGTTGTAAATTGAAAAAGATTGCGAATAAAAATCAACAAATGTGAAAGCCCAGGAAAATATATTTGGTATTTCTGGTTTTGCTGGATTTTTACATTTTTATATAATAAAAATGCTATTTTGAAATCAAAATTATTTTGACTCAAATGGAATATAATGGAAAGTTAAATGAGTGGTAGGTTGGGG