Transcript asmbl_54494

Sequence
Transcript Sequence for observation asmbl_54494 of TGE0016679:
AAGAATGGAAAGGTTTTAGCTGTTGATATAGATATTGACATTTTGAGAATTTAATGTTCGCTTTTAAAAATTGTGACCCTTTAACATAGTTAACTCCCAGTTTATATTATTTATACTTAGAATACTCGTGAAACTGCCCAGGCCATCAAGGGTATGCATATTCGAAAAGCCACCAAGTATCTGAAGGATGTCACTTTACAGAAGCAATGTGTACCATTCCGTCGTTACAATGGTGGAGTTGGTAGGTGTGCCCAGGCCAAACAGTGGGGCTGGACACAGGGTCGATGGCCTAAAAAGAGTGCTGAATTCTTGCTGCACATGCTTAAAAATGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATATCCAGGTGAACAAAGCTCCCAAGATGCGGCGCAGAACTTACAGAGCTCATGGGCGGATTAACCCCTACATGAGCTCTCCTTGCCACATTGAGATGATCCTTACTGAAAAAGAACAGATTGTTCCTAAACCAGAAGAAGAGGTTGCACAGAAGAAAAAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCCCGGGAGTAAATTTAGCATCAAATAAATGCTAGTAAAAGTAAAAGCAGAATGTCGATTGTCTTTATTAGTAAATATACTTCAGGTCTCCGTGCAA