Transcript asmbl_54493

Sequence
Transcript Sequence for observation asmbl_54493 of TGE0000988:
CTCTCTTCGAGTGTGGAATCCTCTGGTTATCGTCGCCATCCTGGTCTCGGGGGCACCGATCTCAGGGTCTTCGGGAGGAGAATTCTTGCCGTTACTGATTTCTCGCTGAAGGCAGTGTCCTATGCAAGGGGACGTTAGGAGCACCCGATTTGGCGCCCTGGGGCCTTGCGGCCTTTGCCGCCCGAAGAGGGGCGCGATGAGCGGGAATGGGGGCTTCAGGGTGACCTCCGAAAATGGTTCGCTATTCACTTGACCCAGAAAACCCCACTAAATCATGCAAATCAAGAGGTTCAAATCTTCGTGTTCACTTTAAGAATACTCGTGAAACTGCCCAGGCCATCAAGGGTATGCATATTCGAAAAGCCACCAAGTATCTGAAGGATGTCACTTTACAGAAGCAATGTGTACCATTCCGTCGTTACAATGGTGGAGTTGGTAGGTGTGCCCAGGCCAAACAGTGGGGCTGGACACAGGGTCGATGGCCTAAAAAGAGTGCTGAATTCTTGCTGCACATGCTTAAAAATGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATATCCAGGTGAACAAAGCTCCCAAGATGCGGCGCAGAACTTACAGAGCTCATGGGCGGATTAACCCCTACATGAGCTCTCCTTGCCACATTGAGATGATCCTTACTGAAAAAGAACAGATTGTTCCTAAACCAGAAGAAGAGGTTGCACAGAAGAAAAAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCCCGGGAGTAAATTTAGCATCAAATAAATGCTAGTAAAAGTAAAAGCAGAATGTCGATTGTCTTTATTAGTAAATATACTTCAGGTCTCCGTGCAA