Transcript asmbl_54279

Sequence
Transcript Sequence for observation asmbl_54279 of TGE0006272:
CGGGAAGCGAAGACGCAAGCAGCTAGACCGTGGGGAACCGAGGTAGGAGTTAACTGTTGTAGCGGCGGAGGAAGTCGGGAGGACGCCGACGGCCTTGCGGGCCAGTGTTTGGTCCCTTTAACCTGTGAAGATGGTGTTGCTCACGATGATCGCCCGAGTGGCGGACGGGCTCCCGCTGGCCGCCTCGATGCAGGAGGACGAACAGTCTGGCCGGGACCTCCAACAGTACCAGAGTCAGGCTAAGCAGCTCTTCCGGAAGTTGAATGAACAGTCCCCTACCAGGTGTACCCTGGAAGCTGGCCCCATGGCTTTTCACTACATTATTGAACAAGGGGTGTGTTACTTGGTTTTGTGTGAAGCCGCCTTCCCTAAGAAGTTGGCTTTCGCCTACCTAGAAGATTTACACTCAGAGTTTGATGAACAGCATGGGAAGAAGGTGCCCACTGTGTCTAGACCCTATTCCTTTATTGAGTTTGATACCTACATTCAGAAAACCAAGAAGCTCTACATTGACAGTCGTGCCCGGAGGAACCTAGGCTCCATCAACACTGAGCTGCAGGACGTGCAGAGGATCATGGTGGCCAACATCGAAGAAGTGCTCCAGCGAGGGGAAGCGCTCTCAGCATTGGATTCAAAGGCTAACAATTTGTCCAGTCTGTCCAAGAAATACCGCCAGGATGCGAAGTACTTGAACATGCGTTCCACTTACGCCAAACTCGCAGCCGTGGCCGTGTTTTTCATCATGTTGATAGTGTATGTGCGATTCTGGTGGCTGTGAAGTCGCGAATCCAGTCACTGGCAAGGGAGAACGTAGAACCTGACAGGTGTATGTTTTCGGGAAACCGAGCTCACAGAGATATGTATTAGAATCCAACTGGAACTTCCGCCTCTAAAGACCTTGCGAGAAAAGACACATCCTGAAAATGAAAGGTCACACCTCCTTTCATGCAGCTTAACCCCATGTAGAAAGTCTCTTTTGGGGGCAGACGCTTTCTCTGGGTGCTAAGCCGTATGTACGTTAGGGAACAGTAGGTCGTTGCATTTTGTTTTTTCCTCTCCTAGTGTTTTACATTTTTTTAAAGCTGCACTTACTGGGGCATCTTCATCCTCTAACAGAGCCATCAGTGAGATTGGGGTTAACCAACCTGTGCTAGCAGCAGTCTGAAATTCCTTCAGAGAAGGAAGCCCTTTGGGAAGTTTTTGACGATCTAATCAACATTCCTTTTGTCAGCGACATTTGTGATTTTCCGTAATCTGAGTTTTCGATGGCCTTTTCAACAAGACTCCAGCATGTGAAGGTTCATTGCTGTGTGTGCTGCAAAGATCTTGTCTCTTGGCCCCGATAGGAAGTTAACCTTTGTTCCCCTTTTGTATTTTGCTTATTGCACAATTGCTTTAGGGTTAAATTAATTATATTAAGATGCCTTGAAATTATATTATAGCACTCCTTGATTAAGAAGCTAAAATGTTTTCTGTCATTTATTCCTTAAAAGACTTAAGTTAGTTTGGGACAGTCTTTATTTTCAGCATCTGATGTGTGTTAATTAAAGAGGGAGGATAGTACACAGATAGCCAGAGGCCCCTGACTCAATGAGAACAGACCGTGACTGCGGCTTTGTCCCTCCCCTTCCTCACTGTCCCCGCTCGTTTCCCCCACTCTCTTTCCTCCTGCCTCAATTTGCTAACAATTTAAAAACTCTTGTGCCCAATAGTTTCATGTCCCTTAAGTGTCCTCTCAGGACAGTCTCAGATTTCAAAATGGAGAACGTTCAGCTGTGTAGTTCATTACATTTAAGTTTTTGCAGAGTGACAAAAACTACTAAATACGTTTACCCGGAACGTCTCTCAGAGCACCCCACACCTGCTTCAGTTTGTAGAAGTTCTCTGAGAATGTTCTAGACATAGAGAACTCATTTACAGTGGCTTCTGTTCACAAATAAAAGGACCTGCGATTGTCCCCTTTTTGCTCAGGGATAATGGGGATTTCCTTGTACCTTCTGAGACAGAATTTTTAAAATGCGAGGATAGGCCTTTTAGATATGTCACAAGGGTCTGCGCTATGACCTATAACTCCTACATATACTGAAAATATTTCTTTAAATTGTACAGGAAAATGAGCCAACTTCTTACTTCTTAACATCCTGAAAAAACTCCAACCAGTGAGCAATTTTATAATGCTGTGGGGTCATCAAATCTACTGTCCTGATTCCTGATAGAGGAAAAAAAAAATTCTATTTCCTTCTAACAAGGCAAGGAGAAACACTTTTATTCCTGATAATTTACAGAACTAGAATAAAATTTTTGTCTTTCCATTTTGGACCTAAATGTGCCAGTTGGCATTTTGTGCATGGAATATGAAATTACTTTTTATAGAGAATAAGTGCTTTTCGGTCCCAAAGGCTTGTCCCTGAGTAATGATGGTGGTAACGCGAGCCTTCGAAAGGGGGAAAACCTGAGCAGTGGCGCCCTAGCGTCCGGTGCTCCTGGCACAGGGAGCGTGGCAGCTCGTTGTCGAGAGTTGCATGCTGTAACCAAGTGGCCAGCAATGAAATAAATACTTCTAGAATGT