Transcript asmbl_53357

Sequence
Transcript Sequence for observation asmbl_53357 of TGE0016654:
CGACGGCAGGCCGTAGGGCGGTCGGAGGGTTTCCGGTTCCGGTGTAACGTTCGGGCTCCGTCTCAGGGGCTGAAGTTTGTGGGGTGCGGTATTGAATCCTGTTTGAGCTGTCCTCCTTTTCCTGCAGAATGGCACTGTCTAAGAGGGAGCTGGATGAGCTGAAACCATGGATCGAGAAGACAGTGAAGAGGGTGCTGGGTTTCTCAGAGCCCACGGTGGTCACAGCAGCACTGAACTGTGTGGGGAAGGGCATGGACAAGAAGAAGGCAGCTGACCATCTGAAACCTTTTCTTGATGATTCTACTCTCCGATTTGTGGACAAACTGTTTGAGGCTGTGGAGGAAGGCCGAAGCTCTAGGCATTCCAAGTCTAGCAGCGACAGGAGCAGAAAACGAGAGCTAAAGGAAGTGTTTGGTGATGACTCTGAGATCTCGAAGGAATCATCAGGAGTAAAGAAGCGACGGATACCCCGTTTTGAGGAGGTGGAAGAGGAGCCAGAAGTGATCCCAGGGCCTCCCTCAGAGAGCCCTGGCATGCTCACTAAACTCCAGATCAAACAGATGATGGAGGCAGCAACACGACAAATAGAGGAGAGAAAAAAACAACTGAGCTTCATTAGCCCCCCTACACCTCAGCCAAAGACTACTTCTTCCTCCCAACCAGAGCGACTTCCAATTGGCAACACTATTCAGCCTTCCCAGGCAGCCACTTTCATGAATGATGCCATTGAGAAGGCAAGGAAAGCAGCTGAACTACAAGCCCGCATCCAGGCCCAGCTGGCACTGAAGCCAGGGCTCATAGGCAATGCCAACATGGTGGGCCTGGCCAATCTTCATGCCATGGGCATTGCTCCCCCAAAGGTGGAGTTAAAAGATCAAACTAAACCTACACCACTGATTCTCGACGAGCAAGGTCGCACTGTAGATGCAACAGGCAAAGAGATTGAGCTGACACACCGCATGCCCACTCTGAAGGCCAATATTCGTGCTGTGAAGCGGGAACAATTCAAGCAACAGCTGAAAGAAAAGCCATCAGAAGACATGGAGTCCAATACCTTTTTTGACCCCCGAGTCTCAATTGCCCCTTCCCAGCGCCAGAGACGCACTTTTAAATTCCATGACAAGGGCAAATTTGAGAAGATTGCCCAACGATTACGGACAAAGGCTCAACTGGAAAAGCTGCAGGCAGAGATCTCACAGGCAGCTCGAAAAACAGGCATCCATACTTCAACTAGGCTAGCCCTCATTGCTCCTAAGAAGGAATTAAAGGAAGGAGATATCCCTGAAATTGAGTGGTGGGACTCTTATATCATCCCCAATGGCTTTGACCTTACAGAGCAAAATCCCAAGAGAGAAGATTACTTTGGAATCACAAATCTTGTTGAACATCCGGCCCAGCTCAACCCTCCAGGTGATGTATAAATTAGTCAAGGCTCTAGGAAAGTATTATTCAACAGAGCTTTCTGTGATAGTGGACGTGTTCTCTAGCTGTGCTGTCCATACAGTAGCT