Transcript asmbl_53257

Sequence
Transcript Sequence for observation asmbl_53257 of TGE0006217:
ACCATCTTGCTCCTGCCCCTGACAGACTCTGTTCCAGGTCAGTGGGACGCTAAGACCGCCGAGTGACCCCTCGCTGACCATGTTGTCCCGGGTGGTACTTTCTGCCGCCGCCACAGCAGCCCCCTCTCTGAAAAACGCAGCCCTCCTCGGTCCAGGAGTATTGCAGGCAACAAGGATCTTTCACACTGGGCAGCCGAGTCTTGCCCCTGTACCACCTCTTCCTGAATATGGAGGGAAAGTTCGTCATGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCCAAAACCGGTGTAACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTTCTGTCCAAAGAAATATATGTGGTTACCCCAGAGACCATCTCTGCCATATCAACAATAGGGTTGCTTGTCTATGTAATTAAAAAATATGGTGCCTCTATTGGGGAATTTGCTGATAAACTCAATGAGCAAAAAATTGCCCAACTAGAAGAAGTGAAGCAGGCTTCCATCAAATACATCCAGGATGCAATTGATACGGAGAAGTCACAGCAGGCACTGGTTCAAAAACGTCATTACCTTTTTGATGTCCAGAGGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACAAGGAGGTAAAGAGTCGCCTGGACTACCATATCTCTGTGCAGAATATGATGCGTCGAAAGGAGCAAGAACACATGATAAACTGGGTGGAGAAGCACGTGGTACAGAGCATCTCTGCACAGCAGGAAAAGGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGCTTGCAAAGAAGGCCCAAGCACAGCCAGTTCTGTAAATGCGTCTATCCTGATCCAGACAGCTAGAAACAGTTGACTGACTAAATGGAAGCTAGCCTATGGGACAGAATCTTTCTGTACTGCGTTCTACTGAAGTTTCATTTCATCTTACCTGAAAATGAAAAGCTTGGGTTCATATAGAAAGAGAATTAAAACAATATTTTGGTCAGTGAGATGCTTCTTGTCCTTCTTGCTCTGCATTTTAAGTTGGTCCATGATCACTTTTGATTCAGCAGTTTGCTTTTAATAGAATTTAGTGCCTGACTAGAGACTACCAAGTTACAGTTTAAATTTGTAATTTATTCTACCATCTTGCAATAGACTGACAGTTGAAACAAGGTTTTTCAGATTGCATAATTTTCTGAAATATTATTTCAATCTTTGCCATATGGGTAAAAATTAAAGATGCCATTGAACTGATAATCTTGTTTTAAGGTTACTAGTGGTAAGCTATTTCTGGCTAATAGGTCATGGGAAATTTAAAGCTTTTCAATATTCTTAAAATAACTAAAA