Transcript asmbl_52961

Sequence
Transcript Sequence for observation asmbl_52961 of TGE0006193:
TTTTTCCCCCCGGAGCTGTGCTTGGCCTGTAGGTCTGTGACGAGCCGCGAACGCGGGTCTCTCTGTTCCGCAGGATGGGGTTTGTTAAAGTTGTCAAGAATAAGGCCTACTTCAAGAGATACCAAGTGAAATTCAGAAGACGACGAGAGGGTAAAACTGATTACTATGCCCGAAAACGTTTGGTAATCCAGGATAAAAATAAGTACAACACACCCAAATACAGGATGATAGTTCGTGTAACCAACAGAGATATCATTTGTCAGATTGCTTATGCCCGTATAGAAGGAGATATGATAGTTTGTGCAGCTTATGCTCATGAACTTCCAAAGTACGGTGTGAAGGTTGGCCTGACAAATTATGCTGCAGCATATTGTACTGGCCTGCTGCTGGCCCGCAGGCTTCTCAATAGATTTGGCATGGACAAAATCTATGAAGGCCAAGTGGAGGTGACCGGAGATGAATACAATGTGGAAAGCATTGATGGTCAACCTGGTGCCTTTACCTGCTATTTGGATGCAGGGCTTGCAAGAACTACTACTGGAAATAAAGTTTTTGGGGCCCTGAAGGGAGCTGTGGATGGAGGCTTGTCTATTCCTCACAGTACCAAACGATTCCCTGGCTATGATTCAGAAAGCAAGGAATTCAATGCAGAAGTACATCGGAAGCACATCATGGGTCAGAACGTTGCAGATTACATGCGTTACCTAATGGAAGAAGATGAAGACGCTTATAAGAAACAGTTCTCTCAATACATAAAGAACAACGTAACTCCAGACATGATGGAGGAGATGTATAAGAAAGCTCATGCTGCTATACGAGAGAATCCAGTCTATGAGAAGAAGCCTAAGAAGGAAGTTAAAAAGAAGAGGTGGAACCGTCCCAAAATGTCTCTTGCCCAGAAGAAAGATCGGGTAGCTCAGAAGAAGGCAAGCTTCCTCAGAGCTCAGGAACGGGCTGCTGAGAGCTAATAAACCAAACTGAAATTTTCTATTAAGATTTTTCATATAAAGATAGTAATAAACTTATTGAATCTGC