Transcript asmbl_52817

Sequence
Transcript Sequence for observation asmbl_52817 of TGE0006178:
GGAAGATGGCGGCGTCCAGGTGGCGGTCTTGAGGAGACCGAACCGGTATGGCTTTGGCGTCGGGCCCCGCAAGGCGGGCGCTTCGTCTACCTGGAAGGCTCGGCTTTGGGGGCGACGGGACCCCGAGACGCGGGGCGTACGAGTGGGGCGTTCGCTCCACGCGGAAGCCCGAGCCTCCTCCCCTGGACAGGGTGTATGAAATCCCTGGACTGGAGCCCATCACCTACGCGGGGAAGATGCACTTCGTGCCCGGTCTGGCGCGGCCGGTCTTTCCGCCGTGGGATCCTGGCTGGACGCACCCAAAGTTCCGCCGCGCGCCCCCGATCCAAGAGCATCCGCTGTACAAGGACCAGGCCTGCTACACCTTCCACCAGCGTTGCCGCCTCCTCGAGGGTGTAAAGCAGGCTCTCTGGCTTACCAAGGCCAAGTTAATAGAAGGCCTTCCTGAGAAAGTGCTTAGCCTTATTGAGGATCCAAGGAACCACATAGAGAACCAAGATGAACGCGTTCTGAATGTGATCTATCACGCCCGTCTCTGGCACTCCACTGAAAACATCCCCAAGAGAACGACCTACTGCCCAATCATTGTGGACAGTCTGTTACAGCTGTGTAAATCCCAGACTTTCAAGCATCCTTCACTAGCCAGGCGGATCTGTGCCAAAAACTACACGTTATCCACCACTTGGAATCGAGAGTCTCTTCTCCTTCAGGTCCGTGGTTCTAGTGGAGCCCGACTGAATGCCAAGGACCTTCTGCCCCCCATTGCCTCCAGAGAGGAGGTAGAAGCTACTAAGAATCATGTTCTTGAAACCTTCTATCCCATATCTCCCACTGTCGATCTTCAGGAATGCAATGTTTATGATGTGAAAGACGACACAGGATACCGGGAGGGTTATCCTTATCCCTATCCCCACACCCTGTATTTTCTGGAGACAGCCAATTCACGACCATACCGCTTTCAACCAGATCAGCTGCGGGCCAAGATGATCCTGTTTGCCTTTGGCAATGCCTTGGCTCAGGCCCGGCTCCTCTATGGGAATGACACTAAGGTTTTGGAGCAGCCAGTAGTTGTGCAGAGTGTGGGCACCGATGGACGTGTCTTCCAGTTCTTGGTGTTACAACTGAACACCACAGATCTGGCCTCTAATGAGGGCATCAAGAATCTGGTGTGGGTGGACTCAGACCAGCTCCTCTATCAGCATTTTTGGTGTCTCCCAGTGATCAAAAAGAAGGTGGTTGTGGAACCTGTTGGGCCGACTGGTTTTCAGCCAGAGACGTTCAAGAAGTTTTTAGCTTTGTATTTGCACGGTGCTGTATGAGCCAAGGACTGTTCTGCAGCCTCACGTACCCCCTCGCTTCAACCCACCGAAGACCCTGCAGCCTGGGCAGGGCCTGGGGTCTGCCCGGAGCCTCAGTGCTCTTTTGGCCTGGTGGGCTCGCTGACAATAACGAGTGCTTCCAGTGCACTGGAGTCTGTGCTTGGTGTGAGGGTGCTGTTGGGAGGGACATCCAGTTTCATGTGGGCCCACACCTTGAGCCTGCCGCCATATAAATGCAGGCCCTGGAGTCTGACCTGCCGCATCTCTGCCCACCACCCATTTTGTGACTTTAGATAAAAGTCTTCATCTAAGTTTCAATTTCTTCATCTGAAACTTGGGCCTAACATAACCTACCTTATTTTGAAGACTATAGCTTATGTATGTGTATTGTCTGTCACATAGTAGGTGCTCTGTGATGGTTGCTCAGTTCTTTTGGGGTTATTTAAATTGTGGACACATTCACAATGACTGCAGAAATTCTGAATAGAATATTCATTGTAGATTTCTCAGCTAGTGTCCTGGTTACTGGACCAGTACACCCCTGGTTCAGCTGGCCTCCTATTTGTTCTAACAACATCCGGTCCTGCTCTGGGCCAGGTACCTATACACAGCATCTTACTTAATCCTTACACAACTCTTGACAAGGTAAATGTCATTT