Transcript asmbl_52652

Sequence
Transcript Sequence for observation asmbl_52652 of TGE0006146:
CAGCCCTTCTCTAAGCCCCCTCACAGTTCCCCCAAGGAGGGAGCAAGCAATCACGGACCTGAAAGATTCATTCTCCCCACTTGAAACCTGAAAAGAGTGGGCCACACAAAGTCTTACTGGTTCCAGGTGAAAACAGTAACTGAAGATGTCAAGCAAAACAGCAAGCACCAACAACATCACCCAGGCACGGAGAACTGTGCAGCAGTTAAGACTAGAAGCCTCCATTGAAAGAATAAAGGTTTCAAAGGCCTCAGCGGACCTCATGTCCTACTGTGAGGAGCATGCCAGGAATGACCCTTTGCTGATAGGGATACCTACTTCAGAAAACCCTTTCAAGGATAAAAAAACTTGCATCATCTTATAGAGGAGTGAAATGGTTCCTCACGTCTTCTCAACAAAGCAAATTATGAGCAGCTCCTTGAAGAGAATTACCTTCAGCTTATTTGGTAACCACTGCTAATAACTAAAATGCTCTTAACATGGAATAATAGACTCTGAAGTCTTTATTTTCCAACTTGTCCTTTCTCTGAAATACCCTTTACTGATTTAATACAATCCCATTTTCCATTTGGCAACTGTGGTGTCATATTGGGTTACTGATTAAGGAAAGTCAGTCCGGGCCCTTTAAAAAACTCAGTTATATACTTTTAAATATATGAATGATCCAGTTATATCAAGACCTAAATTAACTAAGCCCCTATCTAGATTAAAATGCCAAGAGTAATTTAAGTCCTTAAACCTTTATATCATAATGTGTTCTTAATAGGGTTGTGCCAACCTGTACAGTATACACGGGTGAGGAGTGTTTTGTGTATATATGTATGTCTTTGTATATACACATCTCAAAGCTTATTTCCTTATTAAAATTTCTCTCTCTCCATACCATCAGTTAAATCCACAAGTTATACCTTTATCTTAAGCTGTGTGTAGGTAGAATAAGAACTTCTTTTCATATAGTTATTGTACAAAAAGTAAAGGACATCCTAAAGGTCGTATTCATTGTAATCAAATAATGAAGTCATCTCTTGCTGACCCTCTAGTCTACAATAAACTGTGCCAATTAAAATTTTAAAACTCAGCTAAAAGCCCTTTTATAATATGATATTCATTCACCAGGGGCCTTTTCGGGCTTCAGTGATCCTGAGTCTAAAAAAAGGGGAGGACAGTGGGCAGCTGTGTCCCCAGGGCTCACATTCTCTGGATTAGGGGTTACATCTCTGAAGTTTTCACCCTAATGATGGGGATGAAACAGAGTACACAGGAGGCTGGCCGAGAGTTTTTTTTCCTGTTCTTGGCCGAACTTTATGATTTAGCTCTTTTTCTCTCTGCCTTTCCTATATCTTTCCTCTCCTGCTAGAAAATCTATTCCAGCCCCAAGTGGGTGGAACATGGTGGGAAAGAAACATACAAAATCATAAAGGTATCAAGACACAAGCTCTTTTCAAATATCTTCAGTGTCAGCCTCATCCCTACCTTGTCCCCGAACCATCCAAGAGAGGCTTGGTTTCAGTGGTACAGAATTTGGGCCCAAGGGTCCCAGGAGCTGGACATTGGGTTCCTTGATTTTCCTCTGGACACGAATGTAGCCCTCACATCCTCGGGATTTCCAGTGGGTATCCCAAAAGAAGGAATCTCCTATGACCAGAGAGTATTTTAACTTTATCAAAGAAGAAGACAGGTTATTTTTCTTAAATGCTCATTTAAGGGCCCAAAACATACACTTGGCCTATAATATTTTAATTCATCTTCAGTTCGTTAAAAATAACGACAAATGATGAAGGGTTAAAAATGTATTCTCAAAGAGGATTCAAGCCCAAGAAGGAATTATTTACAGTGGTTTTCCCTAGTTCTGTACAATCTCGCCCTGCAGTGCAAGCCCCTTTTAAAATCTAATGTCTGAGCTTTGGATAGTATGCTAATTTGAGTGAACAAATGCAGTACTATTTTTAAACTGCTCAAATATATTCAGTATTTCTCCAACTCACCTATCTATTCGGCATTGTGAACTGCCCTCATATTTCTAAGACTGGGTGAAAATCATGGCACTGCCCTTAACTTCTTGTCATCTACTGCTTGGTTCAGCAATATGCCCAATTCCCAAGTAAATTATAGTTACCTGTTTAGGAGAGAGAAAGATTTTACCTTTCAGAAGGTGAAATTTGAAATGTATGCTAAAAAGATGACTTTACCTTTAATGATTAACTTAAGGAGATATTCTTTTTTAAAATAAATATATTTTTCTGATAGTTTCAGAACACTAATCTTATTTTCACTCCGATGTTTAACATGTTTCTTTAAATATTTATAATGCATCTTGTTACAAAGTATTTTCATGAAATTATGTTTATTATATTGTTATGTGCACAGTTTTTGGTAGCAAGCATAGTACTAAAACATGTTCTTTTACCTAACAGAAAACAAATATGTTTTGCTATATATTTGTTAATATGCTTAAAGTGGTAAGGAATGGACTTGAGGTCCCAGGAGATTTCATTTTATTTTTGCTGGCCAGGTATCCATTAAGGCCATGAATATAAATGTCGTGTAACTTCCTAACCAGGTGTGGGGCATGTTTAAGAAAAGTGAAATCAAATCCTTTGATGCTGGACCCAAGAGGGGAAAAATTGTAGTTAAATGTTGATTTACTTATAACTAGACATCTGTGTGAGAAAATATATGTATACACATATATGATATGCAGAAGTCACTATTTATCAGGCTTTATTCTACTTACAAAGCCACAGTTTGACTGTTCTGCAGCAGCTGGTTTATGACAATGGTGGACAAATGCCCAGTGCGTGTTAATTTTTCCAGCTACCATCATAATGACATAATCACGTATATATATGCAGCCATTTAAATATTTTCACTGTACTTTATCTTTAATGCTGCTTCTGTTAACAGTGATTTTTTTTTTCATTTTTATATTTTTATTAGTTCATCATAATCCTGTCCATTGAGGCCTCAGGACCATGGCAAGATATGCTATACAAAATTTCATGACTCCAAAGAATTTTACAGAACATTTTTTTTTCTATAAACACTTCATATACCAGGTGGTTCACAGGTTATAGGTAGTAACTAC