Transcript asmbl_52650

Sequence
Transcript Sequence for observation asmbl_52650 of TGE0006146:
AAGTCTGGACATGTTTGAAAGGAGTGGGTCATATTCCTTGCTGTAGTTTTGTCGGAGAAGGTTCCAGGTGAAAACAGTAACTGAAGATGTCAAGCAAAACAGCAAGCACCAACAACATCACCCAGGCACGGAGAACTGTGCAGCAGTTAAGACTAGAAGCCTCCATTGAAAGAATAAAGGTTTCAAAGGCCTCAGCGGACCTCATGTCCTACTGTGAGGAGCATGCCAGGAATGACCCTTTGCTGATAGGGATACCTACTTCAGAAAACCCTTTCAAGGATAAAAAAACTTGCATCATCTTATAGAGGAGTGAAATGGTTCCTCACGTCTTCTCAACAAAGCAAATTATGAGCAGCTCCTTGAAGAGAATTACCTTCAGCTTATTTGGTAACCACTGCTAATAACTAAAATGCTCTTAACATGGAATAATAGACTCTGAAGTCTTTATTTTCCAACTTGTCCTTTCTCTGAAATACCCTTTACTGATTTAATACAATCCCATTTTCCATTTGGCAACTGTGGTGTCATATTGGGTTACTGATTAAGGAAAGTCAGTCCGGGCCCTTTAAAAAACTCAGTTATATACTTTTAAATATATGAATGATCCAGTTATATCAAGACCTAAATTAACTAAGCCCCTATCTAGATTAAAATGCCAAGAGTAATTTAAGTCCTTAAACCTTTATATCATAATGTGTTCTTAATAGGGTTGTGCCAACCTGTACAGTATACACGGGTGAGGAGTGTTTTGTGTATATATGTATGTCTTTGTATATACACATCTCAAAGCTTATTTCCTTATTAAAATTTCTCTCTCTCCATACCATCAGTTAAATCCACAAGTTATACCTTTATCTTAAGCTGTGTGTAGGTAGAATAAGAACTTCTTTTCATATAGTTATTGTACAAAAAGTAAAGGACATCCTAAAGGTCGTATTCATTGTAATCAAATAATGAAGTCATCTCTTGCTGACCCTCTAGTCTACAATAAACTGTGCCAATTAAAATTTTAAAACTCAGCTAAAAGCCCTTTTATAATATGATATTCATTCACCAGGGGCCTTTTCGGGCTTCAGTGATCCTGAGTCTAAAAAAAGGGGAGGACAGTGGGCAGCTGTGTCCCCAGGGCTCACATTCTCTGGATTAGGGGTTACATCTCTGAAGTTTTCACCCTAATGATGGGGATGAAACAGAGTACACAGGAGGCTGGCCGAGAGTTTTTTTTCCTGTTCTTGGCCGAACTTTATGATTTAGCTCTTTTTCTCTCTGCCTTTCCTATATCTTTCCTCTCCTGCTAGAAAATCTATTCCAGCCCCAAGTGGGTGGAACATGGTGGGAAAGAAACATACAAAATCATAAAGGTATCAAGACACAAGCTCTTTTCAAATATCTTCAGTGTCAGCCTCATCCCTACCTTGTCCCCGAACCATCCAAGAGAGGCTTGGTTTCAGTGGTACAGAATTTGGGCCCAAGGGTCCCAGGAGCTGGACATTGGGTTCCTTGATTTTCCTCTGGACACGAATGTAGCCCTCACATCCTCGGGATTTCCAGTGGGTATCCCAAAAGAAGGAATCTCCTATGACCAGAGAGTATTTTAACTTTATCAAAGAAGAAGACAGGTTATTTTTCTTAAATGCTCATTTAAGGGCCCAAAACATACACTTGGCCTATAATATTTTAATTCATCTTCAGTTCGTTAAAAATAACGACAAATGATGAAGGGTTAAAAATGTATTCTCAAAGAGGATTCAAGCCCAAGAAGGAATTATTTACAGTGGTTTTCCCTAGTTCTGTACAATCTCGCCCTGCAGTGCAAGCCCCTTTTAAAATCTAATGTCTGAGCTTTGGATAGTATGCTAATTTGAGTGAACAAATGCAGTACTATTTTTAAACTGCTCAAATATATTCAGTATTTCTCCAACTCACCTATCTATTCGGCATTGTGAACTGCCCTCATATTTCTAAGACTGGGTGAAAATCATGGCACTGCCCTTAACTTCTTGTCATCTACTGCTTGGTTCAGCAATATGCCCAATTCCCAAGTAAATTATAGTTACCTGTTTAGGAGAGAGAAAGATTTTACCTTTCAGAAGGTGAAATTTGAAATGTATGCTAAAAAGATGACTTTACCTTTAATGATTAACTTAAGGAGATATTCTTTTTTAAAATAAATATATTTTTCTGATAGTTTCAGAACACTAATCTTATTTTCACTCCGATGTTTAACATGTTTCTTTAAATATTTATAATGCATCTTGTTACAAAGTATTTTCATGAAATTATGTTTATTATATTGTTATGTGCACAGTTTTTGGTAGCAAGCATAGTACTAAAACATGTTCTTTTACCTAACAGAAAACAAATATGTTTTGCTATATATTTGTTAATATGCTTAAAGTGGTAAGGAATGGACTTGAGGTCCCAGGAGATTTCATTTTATTTTTGCTGGCCAGGTATCCATTAAGGCCATGAATATAAATGTCGTGTAACTTCCTAACCAGGTGTGGGGCATGTTTAAGAAAAGTGAAATCAAATCCTTTGATGCTGGACCCAAGAGGGGAAAAATTGTAGTTAAATGTTGATTTACTTATAACTAGACATCTGTGTGAGAAAATATATGTATACACATATATGATATGCAGAAGTCACTATTTATCAGGCTTTATTCTACTTACAAAGCCACAGTTTGACTGTTCTGCAGCAGCTGGTTTATGACAATGGTGGACAAATGCCCAGTGCGTGTTAATTTTTCCAGCTACCATCATAATGACATAATCACGTATATATATGCAGCCATTTAAATATTTTCACTGTACTTTATCTTTAATGCTGCTTCTGTTAACAGTGATTTTTTTTTTCATTTTTATATTTTTATTAGTTCATCATAATCCTGTCCATTGAGGCCTCAGGACCATGGCAAGATATGCTATACAAAATTTCATGACTCCAAAGAATTTTACAGAACATTTTTTTTTCTATAAACACTTCATATACCAGGTGGTTCACAGGTTATAGGTAGTAACTAC