Transcript asmbl_50745

Sequence
Transcript Sequence for observation asmbl_50745 of TGE0006098:
GGAGGCGTGGGCGCTGGAGAAGGGCGTGCTCGGGCGAGCAGCACTCGCGGCGCCGCAGGACATGAATGCAGTCCAAGTCCTGGGGGTGCCCGGGGGGCATCGTAGCGAAATTGCCTTGCTGGTCCATTGGGAGCGCGTCCAGAACCCCAGGCTTAGCTCTCTTTGCAACACCCAGCCAGGTCCCCACCGGGCACCTGGCCGCGCTCGGCTGTCCGGTCGCGGGCATGCTGCCTTGAGCCGCTGACCCCGCTGGAGACCCTGCATGCCAGCCTGGCCTGAAAACGGAGGACTCCACAGACCCGGTCCTCCCCACACCTCTTCTGCACAGAAGCAAACCCTCCTGACTTAGCCACGGCTTCCAGAACCTCTGAGACGGGAGGCCCCCAGGTTTACCTCATGTTTGGGGCATCTTGCTAGCTATGGCCCTGATCCTAGGCTTCTTGCTGCTGCTGGGGCTGGGCGGGAATACCATTTCAGAGGAGCCGCTGTCATCCAAAAGGACTACTTCTGATGTTCTGGAGTTTAAACTCCGGGAAGTGAAGTATGAGACCGAAGACTCTTATAAACTTGGACCCATTGGCATTCTCTTTCAAGTAGTGCACGTCTTTCTCCACGTGGTGCAGCCCAATGCTTTCCCCGAGGATATTCTCAAGAATGTATTACGAAACAAGTTTGACCTCTCAGCTGATTATAAGAAGATCATCCAGTATGAGCTGGGGATCATTATCTGCGCCGTCCTTGGCCTGCTCTTCATTATTCTGATGCCTCTGGTGGGGTTTTGCTTTGGTTTGTGTCGTTCCTGTAACAAGTGCGGTGGAGAAATGCACCAGCGACAGAAGAGAAACGGGACCTGTCTGAGGAAATACTTTGCAGTCTCTCTCTTGGTGATTTGTATGTTTATAAGCGTTGGTATCATCTATGGTTTTCTGGCAAACCACTACCTGAGGACCCATATCGAAAAGACTCAAAAACTGGTAGACAGCAACTTCAGAGACTTGAGAACTCTCCTGGACGAAACTCCAATGCAAATCGACTATGTACTGGACCAGTATAACACCACTAAGGAAAAGGCATTTTCAGATCTGGACAATGTTAAATCATTGCTGGGAGGCAGAATTCGCGATCAGCTAAGACCTAAAGTGATCCCTGTTCTTGATAACATCAAGGCCATGGTTGAAGTAATCAAAGAGACCAGAGAAGCCCTGTCGAACACGAACAATGCCTTAAAGGACCTGAAAAAATCAATTGCACAACTTGACACCAGCCTGAGTGACGTTAAAACGGACCTGGAGCAGGCACTCAGTGACCCCCTGTGCTCTATACCTCCAATAACCACCACTTGCAACGAGATCTCAATGACTCTAAACCAGCTGGATAACAACACTGACGTGGGAAAGATTCCCTTGTTGGATAATCAACTTGATAATGTTAATCATGTTCTTCAAACAGATTTGTCTAGCCTGGTCCAGAAGGGCTATCAAGCCTTTGATGACATACCTGAGATGGTGCAAAACCAAACCACGAACATAGTATTAGATATCAAAAGTACCTTGAATTCCATTGGTTTAGATATCAAACAAAAAAATGAACAGATTTCTATTCAGAATAAGCTGTCACGTTTCATGGATCCCATTAATTACGTTGAAAGTTATATCTACAACAAATTACGCAAGTTGAAAGAATATGACTCATACAGGTGGCTGAGCAGCTTGGTTATCTGCTGTTTCCTGACACTCGTCACGACTTTTTATTCCTTGGGCATATTATGTGGCATTTTTGGCTATGACCCGAATGCCTCCCCAACGAGAAGAGGTTGCATCTCCAACACCGGGGGCATCTTCCTCATGACTGGGGTTGGAATCAGTTTCCTCTTTTGTTGGCTATTGATGATCATTGTGGTTCTTACTTTTGTTATTGGCGGAAATGTGGAAAAATTGGTCTGCGAACCTTACCAGAACAGGAAGTTATTCCAGGTTTTGGACACACCGTATTTACTAAATGAGAATTGGAAATACTACCTCTCAGGCATAATATTTAACAAACCGGATATCAATCTTACTTTTGGACAAATATACAGCGATTGCAAAGAAAATAAAGGCATATATGCCACACTGAAGCTGGAAAACCGCTACAATATCAGTGAATATCTCAACGTTCAGGAGTACACCGAGAACATAAACAGTTATTTTGACAATCTCAACATAAAGATTGATAACATCGTTCTGCTGGACGACGCGGGAAGAAGAAGTCTCATGGATTTCGTTTCTTCAGGCGTAGATAGAATAAATTATGACGCTTACTTGGCTGAGACAACTAAAGCACCCACAAAAGTGAATCTTTTATTATTTGCAGATGTCCTACAAGAGAAAGCCAACCAATTGCCCCCAGGAAACTTGAGATCGTCCCTGATAAGAAACGAACAGATGATTAGAAGGATTTACCATGACCAAGTCATACCTCTGGAACTATCGATGAAAGGTATATACCGAAGCATCCAGGAGCTTCAATACAAAAGCAGTGGATTGGGGGCGAGTGTGAGCGATATCATTTCCTCTTTGGATTCAGCTCAGAAATTCATCGTCAAGAATATTTCCTCTATTATCATTAAGGCAAGTAAGAAGTATGGGAATACGATACTTGGATATTTTAAACTTTATCTGCAGTGGGTCAAGGTCTCAATCACTGAGCAAATCGCGGCCTGCAAACCTGTGGCCACCGCATTAGATTCTGCTGTGGACGTCTTTCTGTGCAACTACATTGTCGAACCCATGAATCTGTTTTGGTTCGGCATAGGAAAAGCGACCATATTTTTACTTCCAGCAATCATTTTTGCTGTAAAGCTGGCCAAGTACTATCGTCGAATGGATTCAGAAGATGTGTATGATGATGTTGAAACTGTCCCCATGAAAAAGTAAGCCTTTTCTTTTTTAAACCGTATTCATAAGCTCAGATGGGGGGGAGGCTCTTTATTATTATATGATGGACTTTTTAAATTAAGAACATCTTAAAATGAGGTAACGACAGTAGGCGTGCCCAGATTAAAATAAATGCTGATGTCTGTTGAAATAAGGACTGGTAAATAAGGACTGGGCGTTGAAGAAGTATTTGTCGAATTAATGAAAATTTTGTGTGTTAAATTTATGAATATACAAAAGGGTTGTTTTGAGATTTGATCTTTAAAGGGAGCAACATGTAAATATGCCCTTTGGCCTTTTTTTGTGTATTTGACAAGGCGTCAGATATTTTTCATGACTCTTACATTGTCTTTGTCATCCACGATATCGATACTTTGTCTTAGTAATAACATGGTGTTTGTGATGTATTTGTTTTTGTCACAG