Transcript asmbl_50714

Sequence
Transcript Sequence for observation asmbl_50714 of TGE0016548:
GAGTTGCCTGTACCCAACCCAGGAGAGTGGCTGCAATGAGTGTGGCTCAGAGAGTTGCTGATGAAATGGATGTGATGTTGGGCCAGGAAGTTGGTTACTCCATTCGATTTGAAGACTGCAGTAGTGCAAAAACCATTCTTAAGTACATGACTGATGGGATGTTACTTCGTGAAGCTATGAATGATCCCCTCCTGGAGCGTTATGGTGTAATAATTCTTGACGAGGCTCATGAAAGGACATTGGCTACAGATATTCTCATGGGTGTTCTGAAGGAAGTTGTAAGACAGAGATCAGATTTAAAGGTTATAGTTATGAGTGCTACCCTAGATGCAGGAAAATTCCAGATTTACTTTGATAACTGTCCTCTGTTGACTATTCCTGGGCGTACACATCCTGTTGAGATCTTTTATACTCCTGAACCAGAGAGAGATTATCTTGAAGCAGCAATTCGAACAGTGATCCAAATCCATATGTGTGAAGAAGAGGAGGGAGATCTTCTGCTTTTCTTAACTGGTCAAGAGGAAATTGATGAAGCCTGTAAGAGAATAAAACGTGAGGTTGATGATTTAGGCCCTGAAGTTGGTGACATTAAAATCATTCCATTGTACTCTACACTCCCACCTCAGCAGCAGCAGCGCATATTTGAACCTCCGCCTCCAAAAAAACAGAATGGAGCAATTGGAAGAAAGGTAGTTGTGTCAACTAACATTGCAGAGACATCTTTGACAATAGATGGTGTGGTATTTGTGATTGATCCTGGATTTGCGAAACAAAAGGTGTACAATCCTCGAATCAGAGTTGAGTCCCTTTTGGTGACAGCAATTAGTAAAGCCTCAGCTCAACAAAGGGCTGGTCGAGCTGGACGTACCAGACCTGGGAAATGCTTCAGACTTTACACAGAGAAAGCTTATAAAACAGAAATGCAGGATAACACCTATCCTGAGATTTTGCGTTCTAATTTAGGATCAGTTGTGTTACAGTTGAAGAAACTTGGTATTGATGATTTGGTGCATTTTGATTTTATGGATCCACCAGCTCCTGAAACTCTGATGAGAGCTCTAGAACTTTTGAATTATCTGGCTGCTTTAAATGATGATGGAGATCTGACTGAATTGGGATCCATGATGGCAGAGTTTCCTCTAGATCCACAGCTCGCTAAAATGGTTATTGCAAGTTGTGACTACAACTGTTCTAATGAGGTCCTATCTATTACTGCTATGTTGTCAGTCCCACAGTGTTTTGTTCGCCCCACGGAGGCCAAGAAAGCCGCAGATGAGGCCAAGATGAGATTTGCCCACATTGATGGAGATCATCTGACACTGCTGAATGTCTACCATGCTTTTAAACAAAATCATGAATCGGTTCAGTGGTGTTATGACAACTTCATTAACTACAGGTCCCTGATGTCAGCAGACAATGTACGCCAGCAGCTATCACGAATTATGGACAGATTTAATTTGCCTCGCCGAAGTACTGACTTTACAAGCAGGGACTACTATATTAATATAAGAAAAGCTTTGGTTACTGGGTATTTTATGCAGGTGGCACATTTAGAACGGACAGGGCATTACTTAACTGTGAAAGATAACCAGGTGGTTCAGCTGCATCCCTCTACTGTTCTTGACCACAAGCCTGAATGGGTGCTTTATAATGAGTTCGTTCTTACAACAAAGAATTACATTCGGACGTGTACAGATATCAAGCCAGAATGGTTGGTGAAAATTGCCCCTCAGTACTATGACATGAGCAATTTCCCACAGTGTGAAGCTAAGAGACAGCTGGATCGCATTATTGCCAAACTTCAGTCCAAGGAATACTCACAATACTGAATCCAGTGCTCAGAACTGAAGTTATTCAGAGGACAGCTTTAAAAGATGAATGAACTCAAAAGTTCAAGTTGTGCTCTTCACGTTGGTTCAATAATGGCCTTTATTTGAAAGCTTTTTAATTTTTCTTTACAGTAAATATTCCATTCTGATTTCATAAATTAAACATTTATGCCTCCCTTTTGTGTTGACACTGTAGCTCATACTGGAAAAGTCGATCAATGTTTTGCAGTTTATTGAAAGTAGTTCTATATATAACAATGTTATAAGCATTTCTTTAGAAATGGTTGAAAATGCTTCTAAAATGTGATTATCGACCATGGTATGCATGATCGTTGTAATTGTTGACATTCCTTTTAGAAGTTGTGAAATGTTACAACTTGTGCTTATGTAGACACAATCTTCTGTCTCAGTACAGAGGCACTGACTTCAATAAAGTCTATTTATACTAATTTCGGCCAAAGCACTTTGATATCTTTGTTCTATCTTTGTAAAGTATGGCTTCTTCTCTTCCCAATGTGGGACTTTTTCCCCTATTGTAAGTATACTATGATTACGTATTTAGCATCTTCCCTCAAGGACTACTGCTTAGATAAAGTAGTCTTTAAAAACATATCTTGGCACTTTGTTAGGTTAATCAGGATGTGATCTAATGGGATAAAGTACGTAGTTTTTATTCAGAATTGGATCCCAAAAGGCAATAATGAAAGAGTTTTTCCTTCATCGTAGGGTTCATTTTATGTGGCTGGTAATTATTATTTTGTTAACCACATTTTGCAGACCTTTTTGTTAGAGAACCATTCTGAGTCCTCTGCCTCTGAAACCAGTTTGTTGGAGATCTTGGTCTCAGTGTTGGGTGTTTCATGCACTGTGCAGAAGTAATAAGTAGGTTAAAATGTGAATTTGACTTTTCATTTTCTGTAACAGGTAGTAG