Transcript asmbl_50681

Sequence
Transcript Sequence for observation asmbl_50681 of TGE0006087:
GTCCTTTCTCACTGCCGTCTTGTGCGGGAGGCTTGTCCCTCCCTACCTGCTGCTCCAGGCTGAGGCTTCCCTAGTGCATCTGTCCGCCGATTCATGATTTTCTGCCGTTTCTTGGCAAAAATGGCAAACAATGATGCTGTTCTGAAAAGACTGGAACAGAAAGGTGCAGAGGCAGATCAAATTATTGAATATCTTAAGCAGCAAGTTGCTCTTCTTAAGGAAAAAGCAGTTTTGCAGGCAACTTTGAGAGAAGAGAAGAAACTTCGAGTTGAAAATGCTAAGTTGAAGAAAGAAATTGAAGAATTGAAGCAAGAACTAATTCAGGCAGAAATTAAAAATGGAGTGAAACAAATACCATGTCCACCTAGTACTCTACTGCAAGCTAATTCCACGGTTTCTGAAAATGTGATGCAGTCCGTACTATTAACAACCATGTCTTCTGGTACCAAAGAACAGATAAAAGGAGGAGGAGAAGAAGCAAAGAAGGTGAAAGAGAAAATTGAAAAGAAAGGAGAGAAAAAGGAGAAGAAACCTCAATCAGTAGCAGGAGGTGCTGACTCTAAGCCAATAGATGTTTCCCGTCTGGATCTTCGCATTGGTTGTATCATCACTGCCAAAAAACATCCTGATGCAGATTCTTTGTATGTAGAAGAAATAGATGTTGGAGAAGCAGCCCCAAGAACAGTTGTCAGTGGCCTGGTAAACCATGTTCCTCTTGAACAGATGCAAAATCGGATGGTGATTTTACTTTGTAACCTAAAACCTGCAAAGATGAGGGGAGTACTATCTCAAGCAATGCTGATGTGTGCTAGTTCACCAGAGAAAGTTGAAATCTTGGCACCTCCTAATGGGTCTGTTCCTGGAGACAGAATTACTTTTGATGCTTTTCCTGGAGAGCCTGATAAAGAGCTGAATCCTAAGAAGAAGATTTGGGAGCAGATCCAGCCTGATCTTTACACTAATGATGAGTGTGTGGCTACATACAAAGGAGCTCCCTTTGAGGTGAAAGGGAAGGGAGTGTGTAGGGCTCAAACTATGACGAACAGTGGAATAAAATAAAATTAGAATGCTTCAGTTACTGAAATACATTGGAAAAAACTTTAATAACAATAAAAAGAAATACATTTGTCACTTATACCTAAAATATAACTGGCTCTTTGTGCGCTTTCTCTTCTAGACTTAACTAGTCTTTTACCTGGTGTATATTATTTTCAGTTGATTAGAAAAACACTACGTTTTTACCTATGATTTTTGATCCTTTAAAATGTAGGGAGGAAATGGCCTATGTTTTGTGATGATTTATTTTTTAGCAAGG