Transcript asmbl_50438

Sequence
Transcript Sequence for observation asmbl_50438 of TGE0006067:
CGCGGCGCGGCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCCGGGGCCGCCGCGTCGCTCGGGCCCCGCCATGGCCGTCACCATCACACTCAAAACGCTGCAGCAGCAGACCTTTAAGATCCGCATGGAGCTTGACGAGACGGTGAAGGTGCTAAAGGAGAAGATAGAAGCTGAGAAGGGACGTGATGCCTTCCCCGTGGCTGGACAGAAACTCATTTATGCTGGCAAGATCCTGAGTGATGATGTCCCTATCAGGGACTATCGCATAGATGAGAAGAATTTTGTGGTTGTCATGGTGACCAAGGCTAAAACCAGCCCAGGCACATCAGTACCCCCAGAGGCTTCACCCACTGCTGCTCCAGAGTCCTCCACGTCCTTCTCGCCAGCCCCTGCTTCAGGCATGTCCCATTCCCCACCTACCGCCAGAGAAGACAAGAGCCCATCGGAGGAATCGGTCCCCACGACATCCCCGGAGTCTGTGTCAGGCTCTGTTCCTTCTTCAGGTAGCAGCGGGCGAGAGGAAGACGCGGCCTCCACACTAGTGACTGGCTCTGAGTATGAGACGATGCTGACGGAGATCATGTCCATGGGCTATGAGCGGGAACGGGTCGTGGCCGCCCTGAGAGCCAGCTACAACAACCCCCACCGAGCCGTGGAGTATCTGCTCACGGTGAGGTGGGGCTGCTGCCTCCTTGGGAGGCTTTCAAGGAATACCTGGGCTTCAGCACCCTGATGGGTGGTCAGGAAGACAAACCCTGCCCCCCGAAGCCTTTGGGTCATGGTACCAGCCAGGAAAGGCTTCTTGTAGGAGGCCAGACATGGGCAGAGAGGTGGGCCCGTGGAGGGCGGGGCTGACGTCTCACCTGTCTCCTGCCAGAGCTGAGTGTGCAGGAGGGAGGCAGCGGGTGGTCTGTGCATTAGAACTAAATAGGACCCCTGACAGGGAATTCCTGGGAGCCCCGAGCCAGAACATGGTTCTGTCCAGGAGAGCCAGGTGTCCGAGCAGCCAGCTACAGAAGCAGCGGGAGAGAACCCCCTGGAGTTTCTGCGGGACCAACCCCAGTTCCAGAACATGCGGCAGGTGATTCAGCAGAACCCGGCGCTTCTGCCTGCACTGCTCCAGCAGCTGGGCCAGGAGAATCCACAGCTTTTGCAGCAAATCAGCCGGCACCAGGAGCAGTTTATTCAGATGCTGAATGAGCCTCCTGGGGAGCTAGCAGACATCTCAGATGTGGAGGGTGAGGTGGGTGCCATAGGCGAGGAGGCCCCGCAAATGAACTACATCCAGGTGACGCCGCAGGAGAAAGAAGCTATAGAAAGGTTGAAGGCCCTGGGCTTCCCAGAGAGTCTGGTGATTCAGGCCTACTTCGCCTGTGAAAAAAACGAGAACTTGGCTGCCAACTTTCTCCTGAGTCAGAACTTTGATGACGAGTAATGCCGGGAGGCCAGGCTGCCTACCGCCCCACCCCTAACCCCAACTCCAAAAAAGTTTTATAAAAGAAAAAATATATATATATATTCATGTTTATTTAAGAAGTGGAAAAAAATCAAAAACCTTAAAAAAAAAACAGAAAAAAAACACCTCAATTTCCACCCTCCTCAAATGGCCCCCATTCCCATCTTGGCCTGAGAAGACCTGGGCCAGACAGCTGTCCTCCCATCCCCCACCCCAGCCTGCTTCAAGGAGCTGGCAGGACCGGAGGTGACAGATGGGCCCCTCTTGGCCTCTGTCCCAGCTCCCTGCAGCCAGATGGAGAGGCGGCTGCTTGCTTCCCCATCCCCCAAAGCCTGAGACCACCCCCACCCTCTTTCAGGGTGACGGGAAGCCAGAGCCCCAAACTTTGATCCTCCATTGGAGTGGTCCAAATCTTTCCATCTGGGGTGAGCAGTCAGAGACCCAAGTCCCACTCTGCAGTCTGGTCTTGGCTTCCAGCCTGCATCCCTTCACTGGGGAGGAGGCGGCCAGGTTTGTCCTAAGGAAGGGGTAACATCAGAGCTGTTCTAGAAGTCAAGGCCACCCCCACCCCAGAACAGAACCGTGTCTCTGATAAAGGTTTTGAAGTGAATAAAGTTTTAAAAGCCCA