Transcript asmbl_50436

Sequence
Transcript Sequence for observation asmbl_50436 of TGE0016524:
CGCGGCGCGGCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCCGGGGCCGCCGCGTCGCTCGGGCCCCGCCATGGCCGTCACCATCACACTCAAAACGCTGCAGCAGCAGACCTTTAAGATCCGCATGGAGCTTGACGAGACGGTGAAGGTGCTAAAGGAGAAGATAGAAGCTGAGAAGGGACGTGATGCCTTCCCCGTGGCTGGACAGAAACTCATTTATGCTGGCAAGATCCTGAGTGATGATGTCCCTATCAGGGACTATCGCATAGATGAGAAGAATTTTGTGGTTGTCATGGTGACCAAGGCTAAAACCAGCCCAGGCACATCAGTACCCCCAGAGGCTTCACCCACTGCTGCTCCAGAGTCCTCCACGTCCTTCTCGCCAGCCCCTGCTTCAGGCATGTCCCATTCCCCACCTACCGCCAGAGAAGACAAGAGCCCATCGGAGGAATCGGTCCCCACGACATCCCCGGAGTCTGTGTCAGGCTCTGTTCCTTCTTCAGGTAGCAGCGGGCGAGAGGAAGACGCGGCCTCCACACTAGTGACTGGCTCTGAGTATGAGACGATGCTGACGGAGATCATGTCCATGGGCTATGAGCGGGAACGGGTCGTGGCCGCCCTGAGAGCCAGCTACAACAACCCCCACCGAGCCGTGGAGTATCTGCTCACGGAGAGCCAGGTGTCCGAGCAGC