Transcript asmbl_49580

Sequence
Transcript Sequence for observation asmbl_49580 of TGE0016474:
TGCAGTGTATGAAACAGATGTGTTTGTTGTTGGAACTGAGAGAGGACGGGCTTTTGTCAACACCAGAAAGGATTTTCAGAAAGATTTTGTGAAATACTGTGTTGAAGAAGAAGAAAAGGCGGCAGAGATGCATAAAATGAAATCTACAACCCAGGCAAATCGGATGAGTGTAGATGCTGTAGAGATTGAAACACTCAGAAAAACAGTTGAGGACTATTTCTGCTTTTGCTATGGGAAAGCTTTAGGCAAATCAACAGTGGTGCCTGTTCCCTATGAGAAGATGCTACGAGATCAGTCTGCTGTGGTAGTGCAGGGGCTTCCAGAAGGAGTTGCCTTTAAACACCCTGAGAACTATGATCTTGCAACTCTGAAATGGATTTTGGAGAACAAAGCAGGGATTTCATTTATCATTAAGAGACCTTTCCTGGAGCCAAAGAAGCACCTAGGTGCTCGCGTGATGGTAACAGATGCTGAAAGGTCAATGCTATCTTCAGGTGGAAGTTGTGGCCCCATCAAAGTGAAAACTGAACCCACAGAAGATTCTGGTATTTCCTTGGAAATGGCAGCTGTGACAGTAAAGGAAGAATCAGAAGATCCTGATTACTATCAATATAACATTCAAGGAAGCCATCATTCTTCAGAGGGCAATGATGGAACAGAAATGGAAGTACCAGCAGAAGATGATGATTATTCTCCACCTACTAAGAGACCAAAGAGCAATGAGCCACCCCAGCCACCAGTCACAGAACCCGCCAATGCCGGAAAACGGAAAGTGAGAGAGTTCAACTTTGAGAAATGGAATGCTCGAATTACTGATCTGCGTAAACAAGTCGAAGAGTTGTTTGAAAGAAAATATGCTCAAGCTATAAAAGCCAAAGGTCCTGTGACGATCCCATACCCTCTTTTCCAGTCACATGTTGAAGATCTATATGTGGAAGGACTTCCAGAAGGAATTCCTTTTAGAAGGCCATCTACTTATGGAATTCCTCGCCTTGAGAGAATATTACTTGCAAAGGAAAGGATTCGTTTTGTGATTAAGAAACACGAACTTCTGAATTCAACACGCGAAGACCTACAACTTGATAAACCAGCTTCAGGAGTAAAGGAAGAGTGGTATGCCAGAATCACTAAATTACGAAAGATGGTAGATCAGCTTTTCTGCAAAAAATTTGCTGAAGCCTTGGGGAGTACTGAAGCCAAGGCTGTACCTTACCAGAAGTTCGAGGCACATCCTAATGATCTCTATGTGGAAGGACTTCCAGAAAATATTCCTTTTAGAAGTCCCTCGTGGTATGGAATCCCAAGGCTTGAAAAAATCATTCAAGTGGGCAATCGAATTAAATTTGTTATTAAAAGACCAGAACTTCTGACTCACAGTACTACTGAAGTTACTCAGCCAAGAACGAATACACCAGTCAAAGAAGATTGGAATGTCAGAATTACTAAACTACGAAAGCAAGTGGAAGAGATTTTTAATTTGAAATTTGCTCAAGCTCTTGGACTCACAGAGGCAGTAAAAGTACCATATCCTGTGTTTGAATCAAATCCTGAGTTCCTTTACGTAGAAGGCTTGCCAGAAGGAATTCCCTTTCGAAGTCCTACCTGGTTTGGAATTCCACGACTTGAAAGGATTGTCCGTGGCAGTAATAAAATCAAGTTTGTTGTCAAAAAACCTGAACTAGTTATTTCCTACTTGCCTCCTGGAATGGCTAGTAAAATAAACACTAAAGCCTTGCAGTCCCCGAAAAGACCACGAAGCCCTGGGAGTAATTCAAAAGTTCCTGAAATTGAGGTCACTGTGGAAGGCCCTAATAACAACAACCCTCAGACCTCAGCTGTGCGAACCCCTACCCAGACTAATGGTTCTAATGTTCCTTTTAAGCCTCGAGGGAGAGAGTTTTCCTTTGAGGCATGGAATGCCAAAATCACAGACCTAAAACAAAAAGTTGAAAATCTTTTCAATGAAAAATGTGGTGAAGCTCTCGGCCTTAAACAAGCTGTGAAAGTGCCATTTGCATTATTTGAGTCTTTCCCAGAAGACTTTTATGTAGAAGGCTTACCGGAGGGTGTGCCATTTCGTCGACCATCTACTTTTGGCATTCCAAGGCTGGAGAAGATACTCAGAAACAAAGCCAAAATTAAGTTCATTATTAAAAAGCCCGAAATGTTTGAGACAGCAATTAAGGAGAGCACCTCCTCCTCTAAGAGCCCTCCAAGAAAAATAAATTCGTCGCCCAATGTTAATACTACTGCATCAGGTGTTGAAGATCTTAACATCATTCAGGTGACAATTCCAGACGATGATAATGAAAGACTGTCTAAAGTTGAAAAAGCTAGACAGCTAAGAGAACAAGTTAATGACCTCTTCAGTCGAAAATTCGGTGAAGCTATTGGTATGGGTTTCCCTGTGAAAGTTCCCTACAGGAAAATCACAATTAACCCTGGCTGTGTGGTAGTTGATGGCATGCCTCCTGGAGTGTCATTCAAAGCTCCCAGCTACCTGGAAATCAGTTCCATGAGAAGGATTTTAGATTCTGCTGAGTTCATTAAGTTCACAGTCATTAGACCATTTCCAGGACTTGTGATTAATAACCAGTTGGTTGATCAGAATGAGTCAGAAAGCCCAGTGATCCAAGAATCAGCTGAACCAAGCCAGTTGGAGGTTCCTGCAACAGAAGAAATAAAGGAGTCTGATGGAAGCTCTCAGATCAAGCAAGAACCAGACCCTACGTGGTAGACCTCTTCCCTCCTAGGCTTAAAGTATCAGTGGGTGAGAAGAGCTTTTCGGACCTGTTACTGCCCCAAGCTGTGTAATATACTTGTATAACAGAAATACCTTCTATACAAACCTTTTTTTCTACTTTTAGATAGAAATGTCTACTTTTTCAGCAGTTCTGTGAATTGAATTAAAGAGCAGAGTGACTGTAGATTTGGAATGGCTGGTTTACTTTGGAATGTATTATAAGGATTTTACAGCAATGCTGGAAAAACGACAGGGAAAATGACAGGGATGAATCTCACCAGATTTTTTTTATGGATTCAGCAGAGCCTTCAGCTATGGTGTTTATTTTCCAATCAAGTGAAGATATCTCTTACTGGAACATCTCAGCTTCTGCAGTGAAGAAAACACCTGTGATAGTTTAGTTCTTTAGTTTTTCTATTTGAAAAATCATTTAAATGATCCTTTTGTTCACGGCTCTCCTTAATGACTGAGTGAACAGTTAGTATCTGTATATTTGACTAAACCTTTTCCTAAGCTATCTATCATGGTTCATACGTTTTTTATCATAATTAAAAAACAACCATCTGGATTATCTAATAGCCGGTAAGAGGTCAGTATCTCAGTGTGTGGCTTATAGATGGAATACAGAGAACCTCTTCCACATTTACTTTTCATCCAAATAAAATGCATGGTGTACCAGAAGTTTAAGATCAGGTATGACTGTTTGGGCAAGCTAAATGACACTAAAGCCTCACTATCATGTAACCTGTTGTGGTGTGGATTTCTTTGGAACACTGTTCCAGCTTGAATCAATCTCAAGGGGTTTTCATTGCCGTCATTATTTTATAATTCTACTTGTAAAATTGAGGCTCCAGTGTGGGGAATGAAGGGTCATAAGCTAATTATGCACCCACTGATATTCTGCGCCATTTGTAGGAGAATCTTACACATGTTGAGATTTCACAGACAATAAGAGTTGTAAAATCCAAGCTATATGAAAAGCTAGAGTATGTGATGGCATAGAGTGTTCATTAGCTTTATCACAATATTCACAATGGAGAATTATATTACATGGTAGCAGGGATAGGCATTTTTATGTGTTGCTTATATTTTACCTCAAATTAAAATGTAGATATAGGGTAATAAATAAAATCCATCCATGCCTTTCA