Transcript asmbl_49577

Sequence
Transcript Sequence for observation asmbl_49577 of TGE0016472:
TGCAGTGTATGAAACAGATGTGTTTGTTGTTGGAACTGAGAGAGGACGGGCTTTTGTCAACACCAGAAAGGATTTTCAGAAAGATTTTGTGAAATACTGTGTTGAAGAAGAAGAAAAGGCGGCAGAGATGCATAAAATGAAATCTACAACCCAGGCAAATCGGATGAGTGTAGATGCTGTAGAGATTGAAACACTCAGAAAAACAGTTGAGGACTATTTCTGCTTTTGCTATGGGAAAGCTTTAGGCAAATCAACAGTGGTGCCTGTTCCCTATGAGAAGATGCTACGAGATCAGTCTGCTGTGGTAGTGCAGGGGCTTCCAGAAGGAGTTGCCTTTAAACACCCTGAGAACTATGATCTTGCAACTCTGAAATGGATTTTGGAGAACAAAGCAGGGATTTCATTTATCATTAAGAGACCTTTCCTGGAGCCAAAGAAGCACCTAGGTGCTCGCGTGATGGTAACAGATGCTGAAAGGTCAATGCTATCTTCAGGTGGAAGTTGTGGCCCCATCAAAGTGAAAACTGAACCCACAGAAGATTCTGGTATTTCCTTGGAAATGGCAGCTGTGACAGTAAAGGAAGAATCAGAAGATCCTGATTACTATCAATATAACATTCAAGGAAGCCATCATTCTTCAGAGGGCAATGATGGAACAGAAATGGAAGTACCAGCAGAAGATTCTACTCAACATGTCCCTTCAGAAACAAGTGAGGACCCCGAAGTTGAGGTGACTATTGAAGATGATGATTATTCTCCACCTACTAAGAGACCAAAGAGCAATGAGCCACCCCAGCCACCAGTCACAGAACCCGCCAATGCCGGAAAACGGAAAGTGAGAGAGTTCAACTTTGAGAAATGGAATGCTCGAATTACTGATCTGCGTAAACAAGTCGAAGAGTTGTTTGAAAGAAAATATGCTCAAGCTATAAAAGCCAAAGGTCCTGTGACGATCCCATACCCTCTTTTCCAGTCACATGTTGAAGATCTATATGTGGAAGGACTTCCAGAAGGAATTCCTTTTAGAAGGCCATCTACTTATGGAATTCCTCGCCTTGAGAGAATATTACTTGCAAAGGAAAGGATTCGTTTTGTGATTAAGAAACACGAACTTCTGAATTCAACACGCGAAGACCTACAACTTGATAAACCAGCTTCAGGAGTAAAGGAAGAGTGGTATGCCAGAATCACTAAATTACGAAAGATGGTAGATCAGCTTTTCTGCAAAAAATTTGCTGAAGCCTTGGGGAGTACTGAAGCCAAGGCTGTACCTTACCAGAAGTTCGAGGCACATCCTAATGATCTCTATGTGGAAGGACTTCCAGAAAATATTCCTTTTAGAAGTCCCTCGTGGTATGGAATCCCAAGGCTTGAAAAAATCATTCAAGTGGGCAATCGAATTAAATTTGTTATTAAAAGACCAGAACTTCTGACTCACAGTACTACTGAAGTTACTCAGCCAAGAACGAATACACCAGTCAAAGAAGATTGGAATGTCAGAATTACTAAACTACGAAAGCAAGTGGAAGAGATTTTTAATTTGAAATTTGCTCAAGCTCTTGGACTCACAGAGGCAGTAAAAGTACCATATCCTGTGTTTGAATCAAATCCTGAGTTCCTTTACGTAGAAGGCTTGCCAGAAGGAATTCCCTTTCGAAGTCCTACCTGGTTTGGAATTCCACGACTTGAAAGGATTGTCCGTGGCAGTAATAAAATCAAGTTTGTTGTCAAAAAACCTGAACTAGTTATTTCCTACTTGCCTCCTGGAATGGCTAGTAAAATAAACACTAAAGCCTTGCAGTCCCCGAAAAGACCACGAAGCCCTGGGAGTAATTCAAAAGTTCCTGAAATTGAGGTCACTGTGGAAGGCCCTAATAACAACAACCCTCAGACCTCAGCTGTGCGAACCCCTACCCAGACTAATGGTTCTAATGTTCCTTTTAAGCCTCGAGGGAGAGAGTTTTCCTTTGAGGCATGGAATGCCAAAATCACAGACCTAAAACAAAAAGTTGAAAATCTTTTCAATGAAAAATGTGGTGAAGCTCTCGGCCTTAAACAAGCTGTGAAAGTGCCATTTGCATTATTTGAGTCTTTCCCAGAAGACTTTTATGTAGAAGGCTTACCGGAGGGTGTGCCATTTCGTCGACCATCTACTTTTGGCATTCCAAGGCTGGAGAAGATACTCAGAAACAAAGCCAAAATTAAGTTCATTATTAAAAAGCCCGAAATGTTTGAGACAGCAATTAAGGAGAGCACCTCCTCCTCTAAGAGCCCTCCAAGAAAAATAAATTCGTCGCCCAATGTTAATACTACTGCATCAGGTGTTGAAGATCTTAACATCATTCAGGTGACAATTCCAGACGATGATAATGAAAGACTGTCTAAAGTTGAAAAAGCTAGACAGCTAAGAGAACAAGTTAATGACCTCTTCAGTCGAAAATTCGGTGAAGCTATTGGTATGGGTTTCCCTGTGAAAGTTCCCTACAGGAAAATCACAATTAACCCTGGCTGTGTGGTAGTTGATGGCATGCCTCCTGGAGTGTCATTCAAAGCTCCCAGCTACCTGGAAATCAGTTCCATGAGAAGGATTTTAGATTCTGCTGAGTTCATTAAGTTCACAGTCATTAGACCATTTCCAGGACTTGTGATTAATAACCAGTTGGTTGATCAGAATGAGTCAGAAAGCCCAGTGATCCAAGAATCAGCTGAACCAAGCCAGTTGGAGGTTCCTGCAACAGAAGAAATAAAGGAGTCTGATGGAAGCTCTCAGATCAAGCAAGAACCAGACCCTACGTGGTAGACCTCTTCCCTCCTAGGCTTAAAGTATCAGTGGGTGAGAAGAGCTTTTCGGACCTGTTACTGCCCCAAGCTGTGTAATATACTTGTATAACAGAAATACCTTCTATACAAACCTTTTTTTCTACTTTTAGATAGAAATGTCTACTTTTTCAGCAGTTCTGTGAATTGAATTAAAGAGCAGAGTGACTGTAGATTTGGAATGGCTGGTTTACTTTGGAATGTATTATAAGGATTTTACAGCAATGCTGGAAAAACGACAGGGAAAATGACAGGGATGAATCTCACCAGATTTTTTTTATGGATTCAGCAGAGCCTTCAGCTATGGTGTTTATTTTCCAATCAAGTGAAGATATCTCTTACTGGAACATCTCAGCTTCTGCAGTGAAGAAAACACCTGTGATAGTTTAGTTCTTTAGTTTTTCTATTTGAAAAATCATTTAAATGATCCTTTTGTTCACGGCTCTCCTTAATGACTGAGTGAACAGTTAGTATCTGTATATTTGACTAAACCTTTTCCTAAGCTATCTATCATGGTTCATACGTTTTTTATCATAATTAAAAAACAACCATCTGGATTATCTAATAGCCGGTAAGAGGTCAGTATCTCAGTGTGTGGCTTATAGATGGAATACAGAGAACCTCTTCCACATTTACTTTTCATCCAAATAAAATGCATGGTGTACCAGAAGTTTAAGATCAGGTATGACTGTTTGGGCAAGCTAAATGACACTAAAGCCTCACTATCATGTAACCTGTTGTGGTGTGGATTTCTTTGGAACACTGTTCCAGCTTGAATCAATCTCAAGGGGTTTTCATTGCCGTCATTATTTTATAATTCTACTTGTAAAATTGAGGCTCCAGTGTGGGGAATGAAGGGTCATAAGCTAATTATGCACCCACTGATATTCTGCGCCATTTGTAGGAGAATCTTACACATGTTGAGATTTCACAGACAATAAGAGTTGTAAAATCCAAGCTATATGAAAAGCTAGAGTATGTGATGGCATAGAGTGTTCATTAGCTTTATCACAATATTCACAATGGAGAATTATATTACATGGTAGCAGGGATAGGCATTTTTATGTGTTGCTTATATTTTACCTCAAATTAAAATGTAGATATAGGGTAATAAATAAAATCCATCCATGCCTTTCA