Transcript asmbl_49025

Sequence
Transcript Sequence for observation asmbl_49025 of TGE0016458:
GCAGGCTTGTCGGGACATCCAAGGCATTCCCTCAGCTTCTGCCGCCCCGGGATCCTCGGCTCTGGTCCGTCTCCCTGCATCTTCCCGCTGTACCGCTGCACCTCCTCCCTCCTGGGCTTCGGACCCCGGGCATCGCCCCTCCTGAAACATGACTCGCGATTTCAAACCTGGAGACCTCATCTTCGCCAAGATGAAAGGTTATCCTCATTGGCCAGCTCGAGTAGATGAAGTTCCTGATGGAGCTGTAAAACCACCTACAAACAAACTACCCATTTTCTTTTTTGGAACTCATGAGACTGCTTTTTTAGGCCCAAAGGATATATTTCCTTACTCAGAAAATAAGGAAAAGTACGGAAAACCAAATAAACGAAAAGGCTTTAATGAAGGTTTATGGGAGATAGATAACAATCCGAAAGTGAAATTTTCAAGTCAACAGGCATCAGCTAAACAATCAAATGCATCATCTGATGTTGAAGTTGAAGAAAAAGAAACTAGTGTTTCAAAGGAAGATACTGACCATGAAGAAAAAGGCAGCAATGAGGATATGACTAAAGCAATTGACATAACTACGCCAAAAGCTGCCAGAAGAGGGAGAAAGAGAAAGGCAGAAAAGCAAGTAGAAACCGAGGAGGCAGGAGTAGTGACAACAGCAACAGCATCTGTTAATCTAAAAGTGAGTCCTAAAAGAGGACGACCTGCAGCTACAGAAGTAAAGATTCCAAAACCAAGAGGCAGACCCAAAATGGTAAAACAGACCTGTCCTTCAGAGAGCGACATGGTAACTGAAGAAGACAAAAGTAAGAAAAAAGGGCAAGAGGAAAAACAACCTAAAAAGCAGCTTAAAAAGGATGAAGAAGGCCAGAAGGAAGAAGATAAACCAAGAAAAGAGCCAGATAAAAAAGAGGGGAAGAAAGAAACTGAATCAAAAAGGAAAAATTTAGCTAAAACGGGGGTCACATCAACCTCCGATTCTGAAGAGGAAGGAGATGATCAAGAGGGTGAAAAGAAGAGAAAAGGTGGAAGAAACTTTCAGACTGCTCATAGAAGGAATATGCTGAAAGGCCAACATGAGAAAGAAGCAGCGGATAGAAAACGCAAGCAAGAGGAACAAATGGAAACTGAGCAGTAAGTATTTTTTTTTTATTCTAAATTTTGATTTCTTTTTTAAGCTAGCATGACATTTTTAAACAA