Transcript asmbl_48857

Sequence
Transcript Sequence for observation asmbl_48857 of TGE0005949:
GATATAAGCCAGCGCTCGGCAGATAGTGCACTATCTGTGCAGACAGGACGGGAGACCGCGGTGTCGTTTAGCAGAGCAGAACCGAGTTGAGAAGGTCAGGCTCATCTAGAGGGTGTCGGCGGAAACATGGAGAAACGACTCACATATGAAGATTGTCAGTACACTGCAGAATGGCTTCTGTCCCACACCAAGCACCGACCTCAAGTGGCAGTGATCTGCGGTTCTGGGTTAGGAGGTTTGACTAATAAATTAACTCAGACCCAGATCTTTGACTACAGTGAGATACCAAACTTCCCCCAAAGTACAGTGCAAGGTCATGCTGGTCGACTGGTGTTTGGGTTCCTGAATGACAGAGCCTGTGTGATGATGCAGGGCAGGTTCCACCTGTATGAAGGCTACCCGCTCTGGAAGGTGACATTCCCAGTGAGGGTTTTCCAGCTTCTGGGTGTGCACACCCTCGTGGTCACCAATGCAGCTGGAGGGCTCAACCCCAAGTTTGAGGTTGGAGACATCATGCTAATCCGCGATCACATCAACCTACCTGGTATTTGCGGTGAGAACCCTCTCATAGGGCCCAATGATGAAAGGTATGGAGTTCGTTTTCCTGCCATGTCCGATGCCTATGACCGGGAGATGAGGCAGAAGGCTCATAGTACCTGGAAACAAATGGGAGAGCAGAGAGAGCTACAGGAAGGCACCTACGTTATGGTGACGGGCCCCAGCTATGAGACTGTGGCAGAGTCTCGTCTGCTGCAGCAACTGGGTGCAGATGCTGTTGGCATGAGCACAGTACCAGAAGTTATAGTTGCAAGGCACTGTGGACTTCGAGTCTTTGGCTTCTCCCTCATCACGAACAAGGTCATCATGGATTATGAAAGCCTTGAGAAAACAAACCATGAGGAAGTACTAAAGACCGGGAAACAAGCTGCGCAGAAATTGGAGCAGTTTGTCTCCATTCTTATGACTAGCATTCCACTGCCTGACCATGCTAGTTAACCAGCCCTGGGGTGGTCTGGCTTCTCCCTTATGGTTTCCAAGTAGTTGCTACCTACTTTGCTGGGGTCACATGCCTCTGTCCTTACGCAGTAGCAGAAAAGAGAGGAAGATTTTTATATTTCCCTTTCCCACTTCTCCCACCAGATTCTTCTGGTGCTGGGTCCTCTTTTGCTCAATTGTCTTCTCAAAACAGTGTCCACCTCTATTCTTTCACAAGAGCTGGAGCTCAAGCCAAGCCCTACTACACATCCATAGATATTTGATGTTGGCTGTTGAACTTGACACAGTAGAAGTCGATGCTAGCTTTTTGAGATGATGTTCTCACATTCCTGGGGACTCAGTTCTGCCTCCCCCAAAGTACTGGAAACCACACAAGGACCAGCCCAATACCTTTTATACTTTTAATGCTTTATATTTTGAAAATAAAGAGAAAGATGAAATAATTTCTTCATTTTTGTACAGTTGGGATTAGGCTGGGGCACAGTCCAAGATTGGCCTGAAAGGCTGTGAGACCACATGTGTTATTATGACTATTTGCTTTCTAGACAGGTAGCTAAGAACTGAGATGAGGCGCTATGTGAATGCAGGGAAGGATGAAGAAAAGGCAAGATGATGAAAGATAAAGATATT