Transcript asmbl_48575

Sequence
Transcript Sequence for observation asmbl_48575 of TGE0009868:
CGGAAATGACGCGAGCGGACAAAGGCAGCGCGCGCCGCGAGGTGTCACGTCTGGCCGCGGTTTGACGGAGGTGGTTGTGGGCTCGTAGGGTCTTCGCTGCCTCCGTCCTCCCTTCCATTTCCGCGTCCTCATCTCCCGGGTCCCGGGGGGCCCCCGCCCGGGGAAGCGCTGTTGCTGAGTTCGGTGTCTGAGCAGAGACGTGGTTGGTGACAGCATGACGAGCGAGGTGATAGAAGATGAGAAACAATTCTACTCGAAGGCGAAGACGTACTGGAAAGAAGTCCCACCGACGGTGGACGGCATGCTCGGGGGGAAGGCCCAAACAAGACGGGCACCTCCTGCGCCCTGGACTGCGGCGCCGGCATCGGAAGGATCACCAAGCGGCTGCTCCTGCCGCTCTTCGGGGCGGTGGACATGGTGGACGTGACGGAGGACTTCCTGGTGAAAGCGAAGACCTACCTGGGTGAGGAGGGCAAGAGGGTGAGGAACTACTTCTGCTGTGGCCTCCAGGACTTCAGCCCAGAGCCTAACTCGTACGACGTCATCTGGATCCAGTGGGTGATCGGCCACCTGACCGACCAGCACCTGGCCGAGTTCCTGCGGCGCTGCAAGCGGGGCCTTCGCCCCAACGGCGTCATCGTCATCAAGGACAACATGGCTCAAGAGGGTGTGATCCTGGACGACGTGGACAGCAGCGTGTGCCGGGACCTCGGGGTGGTCCACAGCATCATCCGCAGCGCGGGCCTCAGCCTCCTGGCCCAGGAGCGGCAGGAGAACCTCCCCGACGAGATCTACCATGTCTACAGCTTAGCCCTGAGATGAGCGGGGCCTGGCAGGACGAGAGAGACAGGTGCAGGGGTGGGGGGAGCTGGCAGCTGGGTGCCACACAGAGGCTCCACGTCGATGGGTCGCGAGTGTCGAGCGAGGCCACTAAATACATCTGCCTGCCGTCCACTCACTACACAGGCTCTTCTTAAAAATGACAGGACCCAGAGGGGAGGGGTGCAGCTGAATGGGCAGCAAGGCAGGAGCCTGGCTCTGCCACCCTAAGGCAAGGGACTGGGCAGTGCAGGCCTGTGCGACTTGGGGGCCCCTCTGCGGGAATACAGTGATCCATCAGAAGCGGAGGTTCCTGGGTCTCTTACGACCACTGGGCCTTGTGGCCCCAGGCCTGGCTGCCTTAAGAGGAAGAGAAACCCCTTAA