Transcript asmbl_48471

Sequence
Transcript Sequence for observation asmbl_48471 of TGE0016411:
GCCGCTTCCCGCCCCCGAGCGCGAGCCGGTTCCGAGCGGAGTGGAGCGGAGGTCGGACCCGGAGCGGAGCCGGCTGAGCGGGCGCTGAGCCCCCGCCATGGCCCGGAACACGCTGTCCTCGCGCTTCCGTCGGGTGGACATCGACGAGTTTGACGAGAACAAATTTGTGGACGAGCAGGAGGAGGCGGCGGCGGCGGCGGGCGAGCCAGGCCCGGACCCCAGCGAGGTGGATGGGCTCCTGCGGCAAGGGGACATGCTTCGGGCGTTTCACGCAGCCTTGAGGAACTCTCCTGTCAACACCAAGAATCAAGCCGTGAAGGAACGAGCCCAGGGCGTGGTGCTGAAAGTGCTTACAAATTTTAAGAGCAGCGAAATTGAGCAGGCTGTGCAGTCACTGGACAGAAATGGCATTGACTTGCTAATGAAGTACATTTATAAAGGGTTTGAGAAGCCCACAGAAAATAGCAGCGCAGTGTTACTCCAGTGGCATGAAAAGGCGTTAGCAGTAGGAGGACTAGGCTCCATTATAAGAGTTCTTACAGCAAGAAAGACTG