Transcript asmbl_46285

Sequence
Transcript Sequence for observation asmbl_46285 of TGE0005782:
GCTTCCGGTGCCGCCGTCGCCGTGCGTCCGTGTTGAGTTTCTGTCTTCGCTGAGCCGCTGTAGTCACCGCGGAGATGCCGCTGGAGAACTTGGAGGAGGAGGGTCTGCCCAAGAACCCCGACCTGCGCATCGCGCAGCTGCGCTTCCTGCTCAGCCTACCGGAGCACCGCGGGGACACGGCCGTGCGCGACGAGCTGATGGCGGCCGTCCGCGATAACAACATGGCTCCTTATTATGAAGCCTTGTGCAAATCCCTTGACTGGCAGATGGACATGGACCTGCTCAATAAAATGAAGAAGGCAAATGAAGAAGAGTTGAAACGGTTGGATGAGGAGCTGGAAGATGCAGAGAAAAATCTTGGAGAGAGCGAAATCCGCGATGCAATGATGGCAAAGGCAGAGTACCTCTGCCGGATAGGTGACAAGGAGGGTGCTCTGACAGCCTTTCGCAAGACGTATGACAAAACTGTTGCCCTGGGTCACCGACTGGATATTGTGTTCTATCTCCTTAGGATTGGCTTATTTTATATGGATAATGATCTCATCACACGAAACACAGAAAAGGCCAAAAGCTTAATAGAGGAAGGAGGAGACTGGGACAGAAGAAACCGCCTTAAAGTATATCAAGGTCTTTATTGTGTAGCTATTCGTGATTTCAAACAGGCAGCTGAACTCTTCCTTGACACTGTTTCAACATTTACATCCTATGAGCTCATGGATTATAAAACCTTTGTGACTTATACTGTCTATGTCAGTATGATTGCCTTAGAAAGACCAGATCTCAGGGAAAAGGTTATTAAAGGAGCAGAGATTCTTGAAGTGTTGCACAGTCTTCCAGCAGTTCGGCAGTATTTGTTTTCTCTCTATGAATGTCGTTACTCAGTTTTCTTCCAGTCGTTAGCTGTTGTGGAACAGGAAATGAAAAAGGACTGGCTTTTTGCTCCTCATTATCGGTACTATGTCAGAGAAATGAGAATTCATGCATACAGCCAGCTGCTGGAATCATATAGGTCATTAACCCTGGGCTATATGGCAGAAGCCTTTGGTGTTGGTGTGGAATTCATTGATCAGGAACTCTCCAGATTTATTGCTGCTGGGAGACTACACTGCAAAATAGATAAAGTGAATGAAATAGTGGAAACCAACAGACCTGATAGCAAGAACTGGCAGTACCAAGAAACTATCAAGAAAGGAGATCTGCTGCTAAACAGAGTTCAGAAACTTTCCAGAGTAATTAATATGTAAAACTATGTAAACAAAGGATTTCCTTTAGAGATAATTATTTCGAATTTTTATAGCTTACTCACTATGTGCCCAGTTCACTTGTATAAAATAAATACTGCATCGTTTCTTTCAATTTACTTTTTTCTTAAACATATCTAC