Transcript asmbl_13731

Sequence
Transcript Sequence for observation asmbl_13731 of TGE0000199:
GCCAGGTGCCTGACTCCCAGAGACGCCCTGCTGGCGGACTTGGAGTCTACCACCTCCCACATCTCCAAACGGCCTGTGTTCTTGTCGGAGGAGACCCCCTACTCATACCCAACTGGAAACCACACATACCAGGAGATTGCCGTGCCACCCCCCGTCCCCCCACCCCCGTCCAGCGAGGCCCTCAATGGCACAATCCTTGACCCCTTAGACCAGTGGCAGCCCAGCAGCTCCCGATTCATCCACCAGCAGCCTCAGTCCTCATCACCTGTGTACGGCTCCAGTGCCAAAACTTCCAGTGTCTCCAACCCTCAGGACAGTGTTGGCTCTCCGTGCTCCCGAGTGGGTGAGGAGGAGCACGTCTACAGCTTCCCCAACAAGCAGAAATCAGCTGAGCCTTCACCCACCGTAATGAGCACGTCCCTGGGCAGCAACCTTTCTGAACTCGACCGCCTGCTGCTGGAACTGAACGCTGTACAGCATAACCCGCCAGGCTTCCCTGCAGATGAGGCCAACTCAAGCCCCCCGCTTCCTGGGGCCCTGAGCCCCCTCTATGGTGTCCCAGAGACTAACAGCCCCTTGGGAGGCAAAGCTGGGCCCCTGACGAAAGAGAAGCCTAAGCGGAATGGGGGCCGGGGCCTGGAGGACGTGCGGCCCAGTGTGGAGAGTCTCTTGGATGAACTGGAGAGCTCCGTGCCCAGCCCCGTCCCTGCCATCACTGTGAACCAGGGCGAGATGAGCAGCCCGCAGCGCGTCACCTCCACCCAACAGCAGACACGCATCTCGGCCTCCTCTGCCACCAGGGAGCTGGACGAGCTGATGGCTTCGCTGTCGGATTTCAAGTTCATGGCCCAGGGGAAGACAGGGAGCAGCTCACCCCCTGGGGGGCCCCCGAAGCCCGGGAGCCAGCTGGACAGCATGCTGGGGAGCCTGCAGTCTGACCTGAACAAGCTGGGGGTCGCCACAGTCGCCAAAGGAGTCTGCGGGGCCTGCAAGAAGCCCATCGCCGGGCAGGTTGTGACCGCCATGGGGAAGACGTGGCACCCCGAGCACTTCGTCTGCACCCACTGCCAGGAGGAGATCGGATCCCGGAACTTCTTCGAGCGGGATGGACAGCCCTACTGTGAAAAGGACTACCACAACCTCTTCTCCCCGCGCTGCTACTACTGCAACGGCCCCATCCTGGATAAAGTGGTGACAGCCCTTGACCGGACGTGGCACCCTGAACACTTCTTCTGTGCACAGTGTGGAGCCTTCTTTGGTCCCGAAGGGTTCCACGAGAAGGACGGCAAGGCCTACTGTCGCAAGGACTACTTCGACATGTTCGCACCCAAGTGTGGCGGCTGCGCCCGGGCCATCCTGGAGAACTATATCTCAGCCCTCAACACGCTGTGGCATCCTGAGTGCTTTGTGTGCCGGGAATGCTTCACGCCATTCGTGAACGGCAGCTTCTTCGAGCACGACGGGCAGCCCTACTGTGAGGTGCACTACCACGAGCGGCGCGGCTCGCTGTGTTCTGGCTGCCAGAAGCCCATCACCGGCCGCTGCATCACCGCCATGGCCAAGAAGTTCCACCCCGAGCACTTCGTCTGTGCCTTCTGCCTCAAGCAGCTCAACAAGGGCACCTTCAAGGAGCAGAACGACAAGCCTTACTGTCAGAACTGCTTCCTCAAGCTCTTCTGCTAGGTGCCCTGCCCCTGTCTCTGCCCCCCTTCCCCAGCCAGCATCCCCAACTGCGACTGTGACCTAGAGACTTCACCCGGGGGTGAAGGGGTAAACCCGACTGAAACTGGAACCCTTGTCCTCCGCTGGTGCGGGATGGACAGAGGGCCGTGAGGGGTCCCCCTGCTTGTCTTCACCCCTGCCAGAGCCTCTGGGCCCCCTCCTCCCTCCTGTAGCTCTCCCTAGGCTGCCCACTCTCCATCCTCCCCAGGGGTAGAGGCTGGGGGCTCCACCCCAGCCCATGTACGTCCCCACGAACTGGCCTGGCCAGCACCCCACACTGGAGCCATCTCTTCCTCATATTTCAGCAGTGCAGCCGGGGGGCAGGGAAGGGCAGGCAGGGTCTGTTGGGGTCTCTTTTTATCCTTATTCCTCCCCCGACCTAATTGTCTTTGTTCTGTGATTATTGGGGGACACCCGGCTCCCTCCAGACAATGCCAGCATAAATCCATCCATCCAAAGGCAGAGAACCAAAGGGGCCATGGAAGGTTCTCTGTGCTCCTCCTACCCTTCCAGTGCCCTAGGCCTGGCGACTGCCCCTGCCTTTTAGACCCGCCCTCCCCTTTTATACCTGCTCTTGTTCTACTGAGAAAAGCCTCTCCAGCAATAATGTTTTCTAGTCACTTCCTCCGTCTCCGGGACGGCGTGCCTGGACACTGTACCGACTTTGATAGATTTCTACACTGAGGTTTGAATTCATATCGCCTGAGTTGCTTTTACTTCTCTATACAAAATGATTTTGAAGAGATTTTAAAGACGTTCCCTTTTGTATTCTCTTCCTCATCCACCGCCACTGGGCCTGTCACTGATGGTGGCTCTGGTGTGAAGTTTGCTTTGTACTGAGGGTTGGGGTGGGGAAGCAATTTGTATTTTATTGTTTCTTAGCACAAGCAGGTGAACTGGGAGCAGCTCTGTGACTCCCCCTCTTTCACTTCATAGCTCACCAGGACTGTTTTATAAACTGCTGTATTTGGAAACCCCTTCTTTACTTCCCAGGCCAGCAAGCTCTTCACTGAAACTGGTTGAAGGGTGTTGCACCCTTTTGGGCCTAGAATTCTGAACTTTATCTGTTCTGTTTCTGTGGGAGGAGAAGGGGAAGTATGTTTTGGGGGGCTGCTTCCTGTCTGAGTAAGCCCTCAGGAGCCTCTGCTCCCCTGTGAACCCACTGAACCTTCTGAGCCCCCACTGCTTCTATGGGGCTCTCTCTTCTGCCTTCTCAGGAAAGCTGGTGTCTGATTTTGGCCATCAGGACTCTGACGTCTCTTTGGTCTTGTTGATTTCCTCTGGGCATATCCCTTCCCCAGATCTGCTCCTCCCCTTTCACAGGTGGGATCGGCACTCAGGGGGTCTGGAAAGAAGGTCATAAGGGAGCATGATAGGATTTGGGGCAGAGGGACAGGCTCCTCTGGGGAAACCCCCCAGAGCTCTTTACCAAGGATGAAAGAGGAGCCAGGCCTTGGGCTCCTGATGAGGAGAAAGGGGCCCCACCGGGGTCTAATGGTGACAGTCCAAACCACTCCACTGGCCTCCTGGCAGAAGCCGAGTGTGCTGGGGTCTCCGAAGAGGGTCCCTCCTTTTTGGGGGAAGGTCAGCCCAGCCCCTCCAAAGGTCTGATGTCTCCACTTTCACCCGCAGGCCTTACCGCTCTGTTTATAGTGACCCACCCTAGATCTTCCCCAAGAGGGACTGGGGTTTCTGGGGTCCATTCTCTGAGTCAGTGGTTATTTGAAAATTTGATTTTGATTTTATTTTTTCTCTGTAAACTTCCAAGCTGGCTTTTCCCATTTCAA