Transcript asmbl_44800

Sequence
Transcript Sequence for observation asmbl_44800 of TGE0005670:
AGAAAGCAAAGCCAGTAGAGTCTTTGTCCTCGGAGGGGGCTCTCCCGGCCACGGGCTCCTCCGAGCCTCCTGGAGGGCAGAGGGGCGCTCCAGGCCCAGAGCTAGGGGCTGGGCGCTTCACTGCCCCTCGGCATCTGCCTGGCAGAGCAGGCGCTCCCTCCCCCCCGTGGTCGTGCTGCCAAGTGAGGCCTTCTCGTTACTGTGGCTCTGATGGTGGGTTTTGCTTGCACGTTCCTTTTCACGGGGGCTGTGGATGGGTGCCAGTCCCCACGCCCCTCACTCTGCCCGTGAGCATTGATCAGCAGCACTTGGGGATTCGCTCGCCAAGCACCGTGCTGGTCCTGTGCTGGTCCCATAGGAAACTAGGGCTCTGGGGACACGGGGACATGGCGGCGTGGGTGCGGGCCCTGCCGATCGACCCCAGGGTTGCGTTTGCCACGCACCACTGACGCCCCTTTCCGTCTCAGCTATGTTCGACCGCGAGAACAAGGCTGGCGTGAACTTCAGCGAGTTCACCGGCGTCTGGAAGTACATCACGGACTGGCAGAACGTCTTCCGCACCTACGACAGAGACAACTCTGGGATGATCGACAAGAACGAGCTCAAGCAAGCACTCTCAGGTTTCGGCTACCGGCTCTCCGACCAGTTCCACGACATCCTCATTCGGAAGTTTGACCGGCAAGGACGGGGGCAGATCGCTTTTGATGACTTCATCCAAGGCTGCATCGTTTTGCAGAGGTTGACAGATATATTCAGACGCTATGATACGGACCAGGATGGCTGGATTCAGGTGTCCTACGAGCAGTACCTTTCCATGGTCTTCAGCATCGTATAACCCAGGACTTCTGCAAACAGCGACGTGATTACGGAAGAGAGACTGAAAATGCCAAACCTCTTACTTTAACAAAATGGAGCACGGACGCATAGACGCTGTTCTTCCTTCAGGGTTCATGTGATTGGTGTTTGGGGACCCAGCTGTACATATGTAGATAATAAGCTGATCGGCGTTTGCACAGTCGTAACGGTGGTCGTGTCGTTACTCAGATGCAAGCATTTGATTTGGGGCTGTTTAATTGTGCCATAAGGTGAGGCCTGAGAATGCTTCAGGTGTTCTGCATGTATAAAATTTATCATGTGCTTTCCTAGATGGTTCTAATTCTGTAGTAGAAATACCTGTATTAACCAATAAGAGTTTTGAATTAATATGTAACTTGCACAGAAGACTTTTCATGTGCCTTACTTTTTAAAAAAAGGGTTTATTGTATTCATTTGAATATGCAGCGTAAGCAATAAAGCAATGTGCCCCTGTCCCATCCGCCTCAGAAGCGCGTGCGGGGTCCGGGGCATGGCTCTGCCTGTGG