Transcript asmbl_44796

Sequence
Transcript Sequence for observation asmbl_44796 of TGE0005667:
CCCTAGGGTCGGCGGTCGGGGGCTGCGGGCCACACCCAGCCCGGGGCGCGGTCTGAGTCGCCGCCGCACCTGTCACCGCTCGACGCCCTTCTGGGCGACTCCGACCGGTCCTGCCGCTTAGTGCGTGTGGGATGCTGGAGACAGCGGAACTAGAGAAACGGAAACGAGGTCGTGTACGCAAGGCGGGTGTCACTCAGAAACGCAGAGCGAAGGCGGGGTCCTGACCGGAGCGCCTGCCTCTGGGCACCTCTGGTATGACAGGCCCGGAGACCCCGCCCACTTTCTAGCCATGGAGGAGACCGGCCGGGAGGCTGTGGCGACCGCGGTGCAGAGGGTGGCCGGGATGCTCCAGCGGCCGGACCAGCTGGACAAAGTGGAGCAGTATCGCAGGCGAGAGGCCCGGAAGAAGGCCTCCGTGGAGGCCAGACTGAAGGCCGCGATCCAGTCGCAGTTGGATGGGGTGCGCGCGGGCCTGAGCCAGCTGCACAGCGCGCTGAACGACGTGAAAGATGTCCAGCAGTCCCTGGCCGACGTCAGCCAGGACTGGCGGCGGAGCATCAATACCATCGAGAGCCTCCGGGACGTGAAGGACGCCGTGGTGCGGCACAGCCAGCTGGCCGCTGCCGTGGAGAACCTCAAGAACATCTTCTCAGTGCCTGAGATTGTGAGGGACACGCAGGACCTCATAGAGCAGGGAGCGCTCCTGCAGGCCCACCGGAAGCTGATGGACCTGGAGTGCTCCCGGGACGGGCTGATGTGTGAGCAGTACCGCATGGACAGCAGGAACACCCGCGACATGACCCTCATCCACAGCTACTTCGGGAGCACGCAGGCTCTCTCTGACGAGCTGGCCAAGCAGCTATGGATGGTCCTGCAGAGGTCGCTGGTCACCGTCCGCCGTGACCCCACCTTGCTGGTGTCCGTTGTCAGGATCATCGAAAGGGAAGAAAAGATTGACAGGCGCATACTCGACCGAAAAAAGCAGACTGGCTTCGTTCCTCCCGGGAGGCCCAAGAGTTGGAAGGAGAAGATGTTTGCCGTCTTGGACAGAACCGTGACCACCAGAATCGAGGGCACACAGGCAGACACCAGGGAGTCCGACAAGATGTGGCTCGTCCGCCACCTGGAGATCATAAGGAAGTATGTCCTGGATGACCTCGTCGTTGCCAAGACCCTGATGGCACAGTGTTTTCCTCCGCATTATGAGATTTTCAGGAACCTCCTGAGCATGTACCACCAGGCGCTGAGCACGCGGATGCAGGAGCTTGCCTCGGAAGACCTGGAAGCGAATGAGATTGTGAGCCTGCTGACGTGGGTCCTGAACACCTACACGAGCGCAGAGATGATGGGGAACATGGAGCTGGCCCCAGAAGTGGACGTCAGCGCCCTGGAGCCTTTGCTGTCTCCACACGTGGTCTCTGAGCTGCTGGACACGTACATGTCGACTCTCACTTCGAACATCATTGCCTGGCTGCGGAAAGCTCTAGAAACAGACAAGAAAGACTGGGTAAAAGAGACGGAGCCAGAAGCCGACCAAGACGGGTACTACCAGACGACGCTCCCGGCCATCGTCTTCCAGATGTTCGAACAGAATCTTCAAGTTGCTGCTCAGATAAGTGAAGATTTGAAAACAAAGGTGCTCGTTTTGTGTCTTCAGCAAATGAATTCCTTCTTAAGTAGGTACAGAGACGAAGCCCAGCTGTACAAGGAGGAGCACCTGAGGGACCGGCAGCGCCCACACTGCTACGTGCAGTACATGGTCGCCATCATCAACAACTGCCAGACCTTCAAAGAATCCATCGTCAGTTTAAAGCGGAAGTATTTAAGAAGCGCAGGCGAAGACGGCGTGTCCGTGAGCCAGCCGAGCATGGACGGCGTCCTGGATGCCATCGCCGACGAGGGCTGCCGCAGCCTGCTGGAGGAGGTCTTCCTGGACCTGGAGCAACATCTCAGTGAGCTGATGACAAAAAAGTGGCTGTCGGGATCGAAGGCTGTAGACATCATCTGCGTCACCGTGGAAGACTATTTCAATGATTTTGCCAAAATCAAAAAGCCATATAAAAAGAGGCTGACGGCCGAGGCGCACCGGCGCGTGGTGGTGGAGTACCTGCGGGCCGTCATGGCGAAGCGCATCTCCTTCCGGAGCCCCGAGGAGCGCAAGGAGGGCGCCGAGCGGATGGTCAGGGAGGCTGAGCAGCTCCGCTTCCTGTTCCGGAAGCTGGCTTCCGGGCTCGGCGAAGAGGCGGATGGGTACTGCGACACGATCACGGCCGTCGCAGAGGTGATAAAGCTGACGGACCCGTCCCTGCTGTACCTGGAGGTCTCGACTCTGGTCAGCAAGTACCCGGACATCAGGGACGAGCACATCGGCGCGCTGCTTGCCATGCGAGGGGACGCCAGTCGGGACATGAAGCAGACCATCATCGAGACGCTGGAGCAGGGCACCACACAGGCGAGTCCGAACTACGTGCCCATCTTCAGGGACATTACGGTCCACAGTCTGAACGTCACCAAGCTCCTCAAATAACTTGTCTCGCCCCGAGTCTGCCCCACCCTCAGCAGTGCGTGACTCTGGAGGCCCAGCGCTCTGGTGGCAGGCCCTGGCCCTGGCCCTGGCCCCCCCCCGGGTCAAGAACGACGTTGCGAGCAGACCCAGGTGCCTGTGCCCCGCGCGCGTCGGCGCTTGTGTAGCTGCTGCTCAATAAAGGCACCGTGGAGCGAG