Transcript asmbl_44794

Sequence
Transcript Sequence for observation asmbl_44794 of TGE0016231:
GGGTCGGCGGTCGGGGGCTGCGGGCCACACCCAGCCCGGGGCGCGGTCTGAGTCGCCGCCGCACCTGTCACCGCTCGACGCCCTTCTGGGCGACTCCGACCGGTCCTGCCGCTTAGTGCGTGTGGGATGCTGGAGACAGCGGAACTAGAGAAACGGAAACGAGGTCGTGTACGCAAGGCGGGTGTCACTCAGAAACGCAGAGCGAAGGCGGGGTCCTGACCGGAGCGCCTGCCTCTGGGCACCTCTGGTATGACAGGCCCGGAGACCCCGCCCACTTTCTAGCCATGGAGGAGACCGGCCGGGAGGCTGTGGCGACCGCGGTGCAGAGGGTGGCCGGGATGCTCCAGCGGCCGGACCAGCTGGACAAAGTGGAGCAGTATCGCAGGCGAGAGGCCCGGAAGAAGGCCTCCGTGGAGGCCAGACTGAAGGCCGCGATCCAGTCGCAGTTGGATGGGGTGCGCGCGGGCCTGAGCCAGCTGCACAGCGCGCTGAACGACGTGAAAGATGTCCAGCAGTCCCTGGCCGACGTCAGCCAGGACTGGCGGCGGAGCATCAATACCATCGAGAGCCTCCGGGACGTGAAGGACGCCGTGGTGCGGCACAGCCAGCTGGCCGCTGCCGTGGAGAACCTCAAGAACATCTTCTCAGTGCCTGAGATTGTGAGGGACACGCAGGACCTCATAGAGCAGGGAGCGCTCCTGCAGGCCCACCGGAAGCTGATGGACCTGGAGTGCTCCCGGGACGGGCTGATGTGTGAGCAGTACCGCATGGACAGCAGGAACACCCGCGACATGACCCTCATCCACAGCTACTTCGGGAGCACGCAGGCTCTCTCTGACGAGCTGGCCAAGCAGCTATGGATGGTCCTGCAGAGGTCGCTGGTCACCGTCCGCCGTGACCCCACCTTGCTGGTGTCCGTTGTCAGGATCATCGAAAGGGAAGAAAAGATTGACAGGCGCATACTCGACCGAAAAAAGCAGACTGGCTTCGTTCCTCCCGGGAGGCCCAAGAGTTGGAAGGAGAAGATGTTTGCCGTCTTGGACAGAACCGTGACCACCAGAATCGAGGGCACACAGGCAGACACCAGGGAGTCCGACAAGATGTGGCTCGTCCGCCACCTGGAGATCATAAGGAAGTATGTCCTGGATGACCTCGTCGTTGCCAAGACCCTGATGGCACAGTGTTTTCCTCCGCATTATGAGATTTTCAGGAACCTCCTGAGCATGTACCACCAGGCGCTGAGCACGCGGATGCAGGAGCTTGCCTCGGAAGACCTGGAAGCGAATGAGATTGTGAGCCTGCTGACGTGGGTCCTGAACACCTACACGAGGTAACTGCGGCTTCACATGTCGCGTTTGCTTGTGCGTAGACGCTGTGAAAAC