Transcript asmbl_13730

Sequence
Transcript Sequence for observation asmbl_13730 of TGE0000198:
GGGCGCGCGCGGCGGCGGCGCGTTCCGTTCCGGGCCGAGGCTCGCGGCGGAAAAGTTGCGGGGCATAGACGAGCGGCCCCGGGACGGGCAGCTAGCGCGACCCTGAGCCGGCGCCCGTGGTCCGGCCATGGACGACCTCGACGCCCTGCTGGCGGACTTGGAGTCTACCACCTCCCACATCTCCAAACGGCCTGTGTTCTTGTCGGAGGAGACCCCCTACTCATACCCAACTGGAAACCACACATACCAGGAGATTGCCGTGCCACCCCCCGTCCCCCCACCCCCGTCCAGCGAGGCCCTCAATGGCACAATCCTTGACCCCTTAGACCAGTGGCAGCCCAGCAGCTCCCGATTCATCCACCAGCAGCCTCAGTCCTCATCACCTGTGTACGGCTCCAGTGCCAAAACTTCCAGTGTCTCCAACCCTCAGGACAGTGTTGGCTCTCCGTGCTCCCGAGTGGGTGAGGAGGAGCACGTCTACAGCTTCCCCAACAAGCAGAAATCAGCTGAGCCTTCACCCACCGTAATGAGCACGTCCCTGGGCAGCAACCTTTCTGAACTCGACCGCCTGCTGCTGGAACTGAACGCTGTACAGCATAACCCGCCAGGCTTCCCTGCAGATGAGGCCAACTCAAGCCCCCCGCTTCCTGGGGCCCTGAGCCCCCTCTATGGTGTCCCAGAGACTAACAGCCCCTTGGGAGGCAAAGCTGGGCCCCTGACGAAAGAGAAGCCTAAGCGGAATGGGGGCCGGGGCCTGGAGGACGTGCGGCCCAGTGTGGAGAGTCTCTTGGATGAACTGGAGAGCTCCGTGCCCAGCCCCGTCCCTGCCATCACTGTGAACCAGGGCGAGATGAGCAGCCCGCAGCGCGTCACCTCCACCCAACAGCAGACACGCATCTCGGCCTCCTCTGCCACCAGGGAGCTGGACGAGCTGATGGCTTCGCTGTCGGATTTCAAGATCCAGGGCCTGGAGCAAAGAGCGGATGGGGAGCGGTGCTGGGCGGCCGGCTGGCCTCGGGACGGCGGGCGGAGCAGCCCCGGAGGGCAGGACGAGGGAGGGGGCTCCTGGCCCCTGGAGGAGGTTGTACTTCTTGTCTCCATCAGCTCATCTGTCCAGGAGGGAGAAAAGTACCCCCATCCCTGTGCTGCCAGACACCGTACCCCGAGCCTCAGGAGTCCTGACCAGCCCCCTCCGTGTCCACAGTTCATGGCCCAGGGGAAGACAGGGAGCAGCTCACCCCCTGGGGGGCCCCCGAAGCCCGGGAGCCAGCTGGACAGCATGCTGGGGAGCCTGCAGTCTGACCTGAACAAGCTGGGGGTCGCCACAGTCGCCAAAGGAGTCTGCGGGGCCTGCAAGAAGCCCATCGCCGGGCAGGTTGTGACCGCCATGGGGAAGACGTGGCACCCCGAGCACTTCGTCTGCACCCACTGCCAGGAGGAGATCGGATCCCGGAACTTCTTCGAGCGGGATGGACAGCCCTACTGTGAAAAGGACTACCACAACCTCTTCTCCCCGCGCTGCTACTACTGCAACGGCCCCATCCTGGATAAAGTGGTGACAGCCCTTGACCGGACGTGGCACCCTGAACACTTCTTCTGTGCACAGTGTGGAGCCTTCTTTGGTCCCGAAGGGTTCCACGAGAAGGACGGCAAGGCCTACTGTCGCAAGGACTACTTCGACATGTTCGCACCCAAGTGTGGCGGCTGCGCCCGGGCCATCCTGGAGAACTATATCTCAGCCCTCAACACGCTGTGGCATCCTGAGTGCTTTGTGTGCCGGGAATGCTTCACGCCATTCGTGAACGGCAGCTTCTTCGAGCACGACGGGCAGCCCTACTGTGAGGTGCACTACCACGAGCGGCGCGGCTCGCTGTGTTCTGGCTGCCAGAAGCCCATCACCGGCCGCTGCATCACCGCCATGGCCAAGAAGTTCCACCCCGAGCACTTCGTCTGTGCCTTCTGCCTCAAGCAGCTCAACAAGGGCACCTTCAAGGAGCAGAACGACAAGCCTTACTGTCAGAACTGCTTCCTCAAGCTCTTCTGCTAGGTGCCCTGCCCCTGTCTCTGCCCCCCTTCCCCAGCCAGCATCCCCAACTGCGACTGTGACCTAGAGACTTCACCCGGGGGTGAAGGGGTAAACCCGACTGAAACTGGAACCCTTGTCCTCCGCTGGTGCGGGATGGACAGAGGGCCGTGAGGGGTCCCCCTGCTTGTCTTCACCCCTGCCAGAGCCTCTGGGCCCCCTCCTCCCTCCTGTAGCTCTCCCTAGGCTGCCCACTCTCCATCCTCCCCAGGGGTAGAGGCTGGGGGCTCCACCCCAGCCCATGTACGTCCCCACGAACTGGCCTGGCCAGCACCCCACACTGGAGCCATCTCTTCCTCATATTTCAGCAGTGCAGCCGGGGGGCAGGGAAGGGCAGGCAGGGTCTGTTGGGGTCTCTTTTTATCCTTATTCCTCCCCCGACCTAATTGTCTTTGTTCTGTGATTATTGGGGGACACCCGGCTCCCTCCAGACAATGCCAGCATAAATCCATCCATCCAAAGGCAGAGAACCAAAGGGGCCATGGAAGGTTCTCTGTGCTCCTCCTACCCTTCCAGTGCCCTAGGCCTGGCGACTGCCCCTGCCTTTTAGACCCGCCCTCCCCTTTTATACCTGCTCTTGTTCTACTGAGAAAAGCCTCTCCAGCAATAATGTTTTCTAGTCACTTCCTCCGTCTCCGGGACGGCGTGCCTGGACACTGTACCGACTTTGATAGATTTCTACACTGAGGTTTGAATTCATATCGCCTGAGTTGCTTTTACTTCTCTATACAAAATGATTTTGAAGAGATTTTAAAGACGTTCCCTTTTGTATTCTCTTCCTCATCCACCGCCACTGGGCCTGTCACTGATGGTGGCTCTGGTGTGAAGTTTGCTTTGTACTGAGGGTTGGGGTGGGGAAGCAATTTGTATTTTATTGTTTCTTAGCACAAGCAGGTGAACTGGGAGCAGCTCTGTGACTCCCCCTCTTTCACTTCATAGCTCACCAGGACTGTTTTATAAACTGCTGTATTTGGAAACCCCTTCTTTACTTCCCAGGCCAGCAAGCTCTTCACTGAAACTGGTTGAAGGGTGTTGCACCCTTTTGGGCCTAGAATTCTGAACTTTATCTGTTCTGTTTCTGTGGGAGGAGAAGGGGAAGTATGTTTTGGGGGGCTGCTTCCTGTCTGAGTAAGCCCTCAGGAGCCTCTGCTCCCCTGTGAACCCACTGAACCTTCTGAGCCCCCACTGCTTCTATGGGGCTCTCTCTTCTGCCTTCTCAGGAAAGCTGGTGTCTGATTTTGGCCATCAGGACTCTGACGTCTCTTTGGTCTTGTTGATTTCCTCTGGGCATATCCCTTCCCCAGATCTGCTCCTCCCCTTTCACAGGTGGGATCGGCACTCAGGGGGTCTGGAAAGAAGGTCATAAGGGAGCATGATAGGATTTGGGGCAGAGGGACAGGCTCCTCTGGGGAAACCCCCCAGAGCTCTTTACCAAGGATGAAAGAGGAGCCAGGCCTTGGGCTCCTGATGAGGAGAAAGGGGCCCCACCGGGGTCTAATGGTGACAGTCCAAACCACTCCACTGGCCTCCTGGCAGAAGCCGAGTGTGCTGGGGTCTCCGAAGAGGGTCCCTCCTTTTTGGGGGAAGGTCAGCCCAGCCCCTCCAAAGGTCTGATGTCTCCACTTTCACCCGCAGGCCTTACCGCTCTGTTTATAGTGACCCACCCTAGATCTTCCCCAAGAGGGACTGGGGTTTCTGGGGTCCATTCTCTGAGTCAGTGGTTATTTGAAAATTTGATTTTGATTTTATTTTTTCTCTGTAAACTTCCAAGCTGGCTTTTCCCATTTCAATTCCTGTGATTTATGCCAATAAAGTTTGCCCATGATTTTCACCTGTGCTAGTGCTA