Transcript asmbl_43900

Sequence
Transcript Sequence for observation asmbl_43900 of TGE0000137:
CGGCTTCCGGTGCTAGGTAGAAGGAAGGAAGGAGGGAGTCAGGGAGCGGGGCCAGGGGAAGAGCTGCGCCGAAATCGGCTGGGGGAGCCGGAGGGAGTGGAGTGAGAGCCAAGCGGAACCTGCGGAGGCGGCGGCCGCAGCGGCGGAGCTTGGAAGCAGGAACAGGACCAAGTCCTCCATACCAGGGACCAGGCCAAAACCAGATTGCCACTGCCCCCACTTGGGCCCAACTGTCCTCAGAAAACAGCTGCTGTGATCATGGGTAATATCTTTGGAAACCTTCTCAAGAGCCTGATTGGGAAGAAGGAGATGCGCATCCTGATGGTGGGTCTGGATGCTGCAGGAAAGACTACCATCCTATATAAGCTGAAACTGGGGGAGATCGTCACCACCATCCCCACCATTGGGTTCAATGTGGAGACAGTGGAGTACAAGAACATCAGTTTCACAGTTTGGGATGTGGGTGGCCAGGACAAGATTCGGCCTCTCTGGAGACACTACTTCCAGAACACCCAAGGGTTGATATTTGTGGTGGACAGCAATGATCGGGAACGAGTAAATGAAGCCCGGGAGGAGCTGATGAGGATGCTGGCAGAGGATGAGCTCCGGGATGCTGTGCTCCTTGTCTTTGCAAACAAACAGGATTTGCCTAATGCTATGAATGCTGCTGAGATCACAGACAAGTTGGGCCTGCATTCCCTGCGTCATCGCAACTGGTACATTCAGGCCACCTGTGCCACCAGCGGGGATGGGCTATATGAAGGCCTGGACTGGCTGGCCAATCAGCTCAAAAACAAGAAGTGAGAGCCAGGCAGCCCTGTCCAGCCGCCCCAGCCACCCTTGACATACCTACTGTCTCCCTGTCCCAACCCTACCACTTCCTTCCCATTGCCAGTGTGGCCAGGACCCTGGGTATCATGTCCGCATGCCCAACAAGAGCCTTGCCTCTCCTGCCTCCCCTCCTTTTTCCTGTCTGTGACCAGTCCCCAGTTGCTGTCTTGATGATGAATCATTCCAATTTATCAGATTTAAAACAAAAACAAGGTTGTTATGGTTTCATGGGTTGCCCCCCTTATACTCCGAGGTTCGAGAGGTGGGGTGGGGTAGTCTCTCTGCTTCGTTTGGCTCTGATTGCTGTGGTCTTGGCATCTGAGTCCCTTCTTCCTACGGGCCCCTCTCCTATTGTCTTCCTTTCCTTTGCCACCTTCTCCCTGTTCTACATGGAAATTGCACGGGCCTCTGTGTGTGCGTGCATGTGTGCGCGTGTATATACATGTACAGAAAAATATATATGTGAGGGCCAGGGAGAAGGGTGGAGGGGGTGGAATGCAGCTCAGGGCTTGGAGCCAGGACACTGCCCACTCTAGCTTATCATCCGCCCCTCCCATGTTGATGAGATAAAGGGAAGAAGGTGGAAGGAAGGCTGCTCCAGTCTTGCTACTGGTTCTTTTCCTCTCTGCAGGTAAGTTTTCCTGGATGATAGGACAGATGATGGATTTTACACTGCCATCTTCCTTGTATCCTTCTCTTCACCCTGCTTAGGGCAGGGAGGCGGCATTTATTTCTAGATTCCCAAGGAGATGCTATTCTGCTCTGCCTTGTTAGTGGGAAGGAGAGAGGAACCCATTCACTCTTATCAGTTCAGAGTGTTCAACTGATTCTCCCCCCACTCATCTTTAGATCTGTTCCTCAGGAGCTTGAGGAAGTGGTGGAGATAGCAAGACTGTGGTGTATGTTTGGGACCCAGAGTACTGGGGGGAGGGCCTCAGGTTTTCCATCTTCATCTTCTTTTGTTTTCAGGAGAAGGGGAGGCATGGATCAGTCCTATTCTTGCCTTCTCTTCCCCTCTGTCCCCCCAATTTTCTCATCTTGGGGGCTGGGTGGTTCATCTGTCCTTCGTCAGAAGTTTCCTCACCCTAGTAGTCCTGCTAGCTTGTCCAAAGCAGGCTTGGTGGTTGAGTGGGGAGTGGAACAGTGGGGGTGACATAGCAGACCTCAATATCAATTCCTCTGTTCTCCAGTATTCTTCTAGAAAGTCCAGGATGTGCTGAAGGATGGCAATTTTCTGTTTCCAGTTCCTCAGACCATCCTGCCATCCCTCCCACCTCCATCCCAACAGCTTTCCCCTGCCCTCTTCACCCACTCATAAATGGATCTGGGGGTTGGAGTGGAGGAAATAGAACTCTGAAGTGGTTATTGGTGCTGGTGGGATGCAGTGGTCTTCAGGGTCCTCCCCCTGTTACGTGGTTGTTTAAAAGCTGCTGCTACTGCGTCCCTCTGTCTACAGGGGGTGCTTGTCCCTGAGGTCCTGACTTCTGCTGTTTCTGTGAAGCCGTGGCTATTCTGTGGGCTCCTGTGTGTGCTGGCTGCGCCCTGAGCTCCATGATGGCCACCCATACCTTTCTGCTAAGGTCAGGACCCAGGGCCACCCCCCATCCCCCACAGCATGGCTGAGGGACCCCTTCGCAGAAGAGCTGTCCCAATCCCCACTCCGTGGGGCCAGGCTTCCTGCCACTTTTGTCTGCAACAGGCAGATCAATACCCCTTACCCCACCCTAGACTGAACTGTGAAAGAGAGGTTCTCGGGGTGTCTCCCTCAGTGCCAGTTCCTTAGTGATGTTTTACTTACCCAAGTTTCAGTGGGTATGTGCAGGTTTTTTGCTCTCTAGGCCTTTGTGTGTATGTGTGTGTGTGTATATGGTGGGGCGAGGGGAGTTGCTGGAGCTTCTGTTTCATTTTAACATGTATTCACTCCCAATTCCACAAATGTGTCCCTCCACA