Transcript asmbl_43258

Sequence
Transcript Sequence for observation asmbl_43258 of TGE0005575:
CTGAAAGATGGCGTCTCGCAAGGAAGGCACCGGCTCTGCCACCACCTCTTCCAGCTCCACCACAGGTGCGGCAGGAAAAGGCAAAGGCAAAGGCGGGTCTGGAGATTCGGCCGTCAAGCAAGTGCAGATAGATGGCTTGGTGGTATTAAAGATAATCAAACATTATCAAGAAGAAGGACAAGGAACTGAGGTGGTTCAAGGAGTACTTTTGGGCCTGGTTGTAGAAGATCGGCTTGAAATCACCAACTGCTTTCCTTTCCCGCAGCACACAGAGGACGATGCCGACTTTGACGAAGTCCAGTATCAGATGGAAATGATGCGGAGCCTTCGCCATGTAAACATTGACCACCTCCACGTGGGCTGGTACCAGTCCACCTACTACGGCTCGTTCGTCACCCGGGCACTCCTGGATTCCCAGTTCAGTTACCAGCATGCCATTGAAGAATCTGTCGTTCTCATTTACGATCCCATAAAAACTGCCCAAGGGTCTCTCTCACTGAAGGCATACAGACTGACTCCTAAACTGATGGAAGTTTGTAAAGAGAAGGATTTTTCCCCTGAAGCATTGAAAAAGGGAAGTATCACCTTTGAGCACATGTTTGAAGAAGTGCCGATCGTAATTAAAAATTCACATCTGATCAACGTCCTAATGTGGGAGCTTGAGAAGAAGTCAGCTGTGGCAGATAAACATGAATTGCTCAGTCTTGCTAGCAGCAATCATTTGGGAAAGAATCTACAGTTGCTGATGGACAGAGTGGATGAAATGAGCCAAGATATAGTTAAATATAACACATACATGAGGAACACGAGTAAACAGCAGCAGCAGAAACACCAGTATCAGCAGCGTCGCCAGCAGGAGAATATGCAGCGCCAGAGCCGAGGGGAGCCCCCGCTTCCTGAGGAGGATCTGTCCAAACTCTTCAAGCCTCTGCAGCCTCCAGCCAGGATGGAGTCTCTGCTCATTGCAGGCCAGATTAATACTTACTGCCAGAACATCAAGGAGTTCACTGCCCAAAACTTAGGCAAACTCTTCATGGCCCAGGCGCTTCAAGAATACAACAACTAAGAAAAAGAAGTTTCCAGAAAAGGAGTTAACATGGACTCTTGAGATCACATTGGGGCAACTCTTGGAAGAAATATGTTTGCATACTGAAAAGTCTTTTTAGCCAATAATAAAGTATAAATAAAACA