Transcript asmbl_42013

Sequence
Transcript Sequence for observation asmbl_42013 of TGE0016110:
CGCGGGGGGAGTGAGGCCGCGCAGGCGCGGACGGCGTTGGTTGAAGAAGACCTTCAGCGTTGCCCTGGCGGAGCGGAGACCGGCTCTCTCTGGGTGGAGATATGTGTAACACACCGACTTACTGTGACCTAGGAAAGGCTGCCAAGGATGTCTTCAACAAAGGATATGGGTTTGGCATGGTAAAAATAGATCTGAGAACCAAGTCATGTAGTGGAGTGGAATTTTCTACTTCTGGTCATGCGTACACTGATACAGGGAAAGCGTCAGGCAACCTAGAGACCAAATATAAGGTCTGTAACTATGGACTTACCTTCACCCAAAAATGGAACACAGACAATACTCTTGGAACAGAAATCTCTTGGGAGAATAAGTTGGCTGAAGGGTTGAAACTGACTCTTGATACCATCTTTGTACCGAACACAGGGAAGAAGAGTGGGAAATTGAAGGCCTCCTATAAACGGGATTGTTTCAGTCTTGGCAGTAATGTTGATATAGATTTTTCTGGACCAACCATCTATGGCTGGGCTGTGTTAGCCCTTGAAGGTTGGCTTGCTGGCTATCAGATGAGTTTTGACACAGCCAAATCTAAACTGTCACAGAATAATTTCGCCCTGGGTTATAAGGCTGCAGATTTCCAGCTGCACACTCACGTGAATGATGGCACTGAATTTGGAGGGTCTATCTACCAGAAGGTTAATGAGAAGATTGAAACGTCAATAAACCTCGCTTGGACAGCTGGCAGTAACAATACCTGTATTGGCATCGCTGCTAAATACAAGCTGGATTGTAGAACTTCTTTATCTGTACTGTGCTAAGGGCTTTACGTGTATTTTCTCATTTAATCCTCAC