Transcript asmbl_42012

Sequence
Transcript Sequence for observation asmbl_42012 of TGE0005512:
CGCGGGGGGAGTGAGGCCGCGCAGGCGCGGACGGCGTTGGTTGAAGAAGACCTTCAGCGTTGCCCTGGCGGAGCGGAGACCGGCTCTCTCTGGGTGGAGATATGTGTAACACACCGACTTACTGTGACCTAGGAAAGGCTGCCAAGGATGTCTTCAACAAAGGATATGGGTTTGGCATGGTAAAAATAGATCTGAGAACCAAGTCATGTAGTGGAGTGGAATTTTCTACTTCTGGTCATGCGTACACTGATACAGGGAAAGCGTCAGGCAACCTAGAGACCAAATATAAGGTCTGTAACTATGGACTTACCTTCACCCAAAAATGGAACACAGACAATACTCTTGGAACAGAAATCTCTTGGGAGAATAAGTTGGCTGAAGGGTTGAAACTGACTCTTGATACCATCTTTGTACCGAACACAGGGAAGAAGAGTGGGAAATTGAAGGCCTCCTATAAACGGGATTGTTTCAGTCTTGGCAGTAATGTTGATATAGATTTTTCTGGACCAACCATCTATGGCTGGGCTGTGTTAGCCCTTGAAGGTTGGCTTGCTGGCTATCAGATGAGTTTTGACACAGCCAAATCTAAACTGTCACAGAATAATTTCGCCCTGGGTTATAAGGCTGCAGATTTCCAGCTGCACACTCACGTGAATGATGGCACTGAATTTGGAGGGTCTATCTACCAGAAGGTTAATGAGAAGATTGAAACGTCAATAAACCTCGCTTGGACAGCTGGCAGTAACAATACCTGTATTGGCATCGCTGCTAAATACAAGCTGGATTGTAGAACTTCTTTATCTGCCAAAGTAAATAATGCCAGCCTGATTGGACTTGGTTATACTCAGACCCTTCGACCAGGAGTCAAACTGACCCTGTCAGCTTTAGTCGATGGAAAGAACTTCAATGCAGGAGGTCACAAGGTTGGGTTGGGATTCGAACTAGAAGCTTAATGTGGTTTTGAATAAAGCATCAAATTTGTTCCTGGAGGTGAAGAGAAATGAATCCACTATGTTTTGGCCTTAAAATTCTTCTCTGAAATTTCAAAAGTGTGAACTTTTTATTCTTCCAAAGAATTGTAATCCTCCCCACGCTGAAGTCTAGAGATCGCAAGTCCACCCTAAGGGAGGTCCTTAAAGGCATGCCTGGAAGTTGTTATGTTTGTGCCACATTTCAGTTCCGCAGTATTATTTTAAATGTGTTCCTCGGCGACAATGTAGTGTCATGTTAAAGGAAATGACTCGATCCTCCAGTTTGTACATCACGTCCTGCATGTCCCACACCACTTTTTCATGACCGTTTAATATATTGGTCTGTGTGCTGTAGTGGAATCTTTGGTTTTGCATCAGGGTATAATAAAATAAACCCATCACATTTGAACATAATTGCTCATCTTACTTGCTAGTAGTGGTTTTCTTATATTTGGTGTGATTTGCTTTGAAAAGTACTCTCATAGGTGAGAGTATATGCCTAAAGTGGTATGTCTGAAACATCTATGCTGTCTCTTGCCTGTCCTTTGCACTTTAGATTACTTCACTCTTATTGCTGCTCTGCAGTTGGGCCGAGGAGTGAAACTGAGTTTTGTTCTGCTGAGCAGAAGCACCTCTCTCGTGGTACCTGCTTCCTATTGCAGTGTGATAGAGTACTTTTGTAAAGCTACTGAGAAAGAGTGAGGGTGTGAGTGGGCAAAAGATGGGCAAAGGAAAGAGTATAATTGGGGGAAATACTGTAGGGAAGAGAGGTGGAAGGAAGGGGG