Transcript asmbl_41969

Sequence
Transcript Sequence for observation asmbl_41969 of TGE0005501:
CCTTCTGCGGCTGCCGTAGCCCCAGACGGTAAACAGGAAATGGGACTCTATCTGGGACTCAATATTCGGGTGAAAAAGACCCGGGATTCAGTTGAGACGTCTACTGCTGCTTTTGCGTACACTTTCAGGGTGTACCGTCCTCCATCTCCACTGTTTGCCTCTCTCTCCTGTTCCTGTTCCAATCAAGGTATTTTGTCTTGAGCCACCTCCCACCTCTTTATCGAGAAGTGTCACCAGAACCATGGCTGAATACTCCTATGTGAAGTCCACCAAACTCGTGCTCAAAGGAACCAAAGCTAAGAGTAAGAAGAAAAAGAGCAAAGAGAAGAAGAGAAAAAGAGAAGATGATGAAGAAACCCAACTTGATATTGTTGGAATTTGGTGGACAGTAACAAACTTCGGTGAAATTTCAGGAACCATAGCAATTGAAATGGATAAAGGAACCTACATACATGCCCTTGACAATGGACTTTTTACACTGGGAGCTCCACATAAAGAAGTTGATGAAGGCCCTAGTCCTCCAGAGCAGTTTACAGCTGTCAAATTGTCTGATTCTAGAATTGCCCTGAAATCTGGCTATGGAAAATACCTTGGTATAAATTCAGATGGACTTGTTGTTGGGCGTTCAGATGCAATTGGACCAAGAGAACAATGGGAACCGGTCTTTCAAGATGGGAAAATGGCTTTATTGGCCTCAAATAGTTGCTTTATTAGATGCAATGAAGCAGGTGATATAGAAGCAAAAAGTAAAACAGCAGGAGAAGAAGAAATGATAAAGATTAGATCCTGTGCTGAAAGAGAAACTAAGAAAAAAGATGATATTCCTGAAGAAGACAAAGGAAATGTTAAACAGTGTGAAATCAATTATGTGAAGAAATTTCAAAGCTTCCAAGACCACAAACTTAAAATAAGTAAAGAAGACAGTAAAATTCTTAAAAAGGCCCGGAAAGATGGATTTTTGCATGAAACACTTCTGGATAGGAGAGCCAAATTGAAAGCTGATAGATACTGCAAATGACCAGGATTTTTATGG