Transcript asmbl_41565

Sequence
Transcript Sequence for observation asmbl_41565 of TGE0005472:
CCAGCTTGGTCCCGGCGGTGTGAGTATGGGCGCTTGGTCTGACCTTCAGTAATCTGGCTCCATCCTCTTCCGGGATTGCGTTCACCGAGACAGCGGGATGGCTCCCGCGAAGAAGGGTAGCGAGAAGAAGAAGGGCCGTTCTGCCATCAACGAGGTGGTGACCAGAGAATATACCATCAACATTCACAAGCGCATCCATGGAGTGGGTTTCAAGAAGCGTGCTCCTCGGGCACTCAAAGAGATCCGGAAATTCGCCATGAAGGAGATGGGGACTCCAGATGTACGCATCGATACCAGGCTCAACAAGGCCGTCTGGGCCAAAGGGATCAGGAATGTCCCATACCGTATCCGGGTGCGGTTGTCCAGAAAACGTAACGAAGATGAAGATTCACCTAACAAGCTCTATACATTAGTTACCTATGTGCCTGTCACCACTTTCAAAAATCTACAGACAGTTAATGTGGATGAGAACTAACTGCTGATTGTCGAATAAAGATACAAAACTGCCTTTGAGGTTTGGTTTCTCGTTTCTGGTTGCAATGTAATAACTGTGTATCTTAAAGTAGTTCCCAATTATAGAATCACTTGGAAAGCTTTTCCTAAGTACTATGCCTGTGTCCTTTGTCCCCAGCCTCTCGAGTTTCTGAATATTTGGACAGGGCCCAAGCAGTTTTAAGTGATTTTGAAGTGTATGTAGCCTCACTTTAGAATAACTGCTTAGGTAGCTGGGAAAGTGGAGATACATAGGTTAGTTTTTTTTACCTGCATGTTTCGTTAATTCTAAGATAAACATTTTTCCAGAAACTGCCATGTAGAACTCAGCTGCTCTTGGCTTCTTTTCATTTTAAACCAAAATGAGGCAATTGACAGCATCTTAGATTTCATGAAATATATTTGGTAGTATGTCCTTAAGCTTCTGCCTATATCTGTATTGAATGTAACTCTCAAAAGGTATATAATTGTCATCTAAAATAGATTTTTGATGGTGTAAATGCTTAATGATATG