Transcript asmbl_41041

Sequence
Transcript Sequence for observation asmbl_41041 of TGE0005450:
CTTTTTCCGTCTCCCGCTGAGGCACCAAGAGGAGCTGTCGCCATGTCCGCCCATCTGCAATGGATGGTTGTACGGAACTGCTCCAGTTTCCTGATAAAGAGGAACAAGCAGACGTACAGCACCGAACCCAATAATCTGAAGGCCCGCAATTCCTTCCGCTACAACGGGCTGATTCACCGCAAGACGGTGGGCGTGGAGCCGGCAGCGGATGGCAAAGGCGTGGTGATCGTCATGAAGCGGAGATCCGGCCAGCGAAAGCCAGCCACCTCCTACGTGCGGACCACCATCAACAAGAATGCCCGGGCCACCCTCAGCAGCATCCGACACATGATCCGCAAAAACAAGTACCGCCCTGATCTGCGCATGGCGGCCATCCGCAGAGCCAGCGCCATCCTGCGCAGCCAGAAGCCCGTGATGGTGAAGAGGAAGCGGGCCCGCCCCACTAAGAGCTCCTGAGACACACACCTCCCCCCTCTGCTCCAAGAAATAAAGGTGTCAGCTGACCCTCAA