Transcript asmbl_41032

Sequence
Transcript Sequence for observation asmbl_41032 of TGE0005446:
AACGATGACCAGGTAGGTCTCTCACTACCCACCCCACCCCACCTTTGCCCAAACCAATCCTAGTGGCGTCATGATCTCCTTGGCAGGTGAAAGAGCTGCTGACATCATTCGGGCCTCTCAAGGCCTTCAACCTGGTTAAGGACAGCGCGACTGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACGGATCAGGCTATTGCGGGGCTGAATGGGATGCAGCTGGGTGACAAGAAACTGCTGGTCCAGAGGGCGAGTGTGGGAGCCAAGAATGCCACGCTGAGCACCATCAACCAGACCCCTGTGACCCTGCAAGTGCCCGGCTTGATGAGCTCCCAGGTGCAGATGGGTGGCCACCCGACCGAGGTCCTGTGCCTCATGAACATGGTGCTGCCTGAGGAGCTGCTGGACGACGAGGAGTATGAGGAGATCGTGGAGGACGTGCGTGATGAGTGCAGCAAGTATGGGCTGGTCAAGTCCATTGAGATCCCCCGGCCCGTGGATGGTGTCGAGGTGCCCGGCTGTGGAAAGATCTTCGTGGAGTTCACCTCTGTGTTTGACTGCCAGAAAGCCATGCAGGGCCTGACGGGTCGCAAGTTCGCCAACAGAGTGGTTGTCACAAAATACTGTGACCCCGACTCTTACCACCGCAGGGACTTCTGGTAGAGGCGGTGGGGGAGGGTGGGGCCGGGCTGGCGTAGGGCTTCTGCCCTGCCACCCCCCCTTTTTCCCCCTCTGAAGACATGGGCAGAGGAGTGACAGCCGAGTGACAGCCGGCAGCAACTGGAATGGCAGCAATTTAAG