Transcript asmbl_41031

Sequence
Transcript Sequence for observation asmbl_41031 of TGE0005446:
CCGGGCTTGATTAGTCAGGAGGCAGAGGCGCGCCGGCGGCGCCCGGAAGTAGCCGAAGCGAGCGGCGGAAGTAGCCGAAGCGTCCGGAGCGGGCGGGCGGCAAGGCGAGGCGAGAGCTGCACAGGGCCCTACGCGGCCGCCTCAGCATGTCGGACTTCGACGAGTTCGAGCGGCAGCTCAATGAGAATAAGCAAGAGCGGGACAAGGAGAACCGGCACCGGAAGCGCAGCCACAGTCGCTCTCGCAGCCGGGACCGGAAGCGCCGCAGCCGGAGCCGCGACCGGCGCAACCGGGACCAGCGCAGCGCCTCCCGGGATAGGCGGCGACGCAGCAAACCTTTGACCAGAGGCGCTAAAGAGGAGCACGGTGGACTGATTCGCTCCCCCCGCCATGAGAAGAAGAAGAAGGTCCGCAAGTACTGGGACGTGCCACCGCCTGGCTTCGAGCACATCACCCCTATGCAGTATAAGGCCATGCAGGCTGCGGGTCAGATTCCAGCCACTGCCCTCCTGCCCACCATGACTCCGGATGGTCTGGCTGTGACCCCGACGCCAGTGCCAGTGGTCGGGAGCCAGATGACCAGACAGGCCCGGCGTCTCTATGTGGGCAACATCCCCTTTGGCATCACTGAGGAGGCCATGATGGACTTCTTCAATGCCCAGATGCGCCTGGGGGGGCTGACTCAGGCCCCTGGCAACCCCGTCCTGGCTGTGCAGATTAACCAGGACAAGAACTTCGCCTTCCTGGAGTTCCGCTCAGTGGACGAGACCACCCAGGCCATGGCCTTTGATGGCATCATCTTCCAGGGCCAGTCGCTGAAGATCCGCAGGCCCCATGACTACCAGCCCCTGCCCGGCATGTCAGAGAATCCCTCTGTCTATGTGCCTGGAGTTGTGTCCACAGTGGTCCCAGACTCCGCCCACAAGCTGTTCATTGGGGGCCTTCCCAACTACCTGAACGATGACCAGGTGAAAGAGCTGCTGACATCATTCGGGCCTCTCAAGGCCTTCAACCTGGTTAAGGACAGCGCGACTGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACGGATCAGGTGAGCCCCAGGCCCATGGCGCGGTTGTGTCTGCCATTGCCTTTACCCTGCTCTGTGTCCACCCGGAGGTCTCCCCTTGGAGTTGGGGAGGAGGCAGCCAGCAGTGGCAGGGCCTGCCTGGGGCTTCCCAAGCTCTTGGCCCCTTGCCTTCCCTTCTTTCCCTTCCAGTGCCCAGCTCTGGGATGCTAGGGTTCAGGGGTGGCGTCGGGCTCCTGGTCCCTGACCCACACCTCTTCCCTACATTCCCCCATCGTCCCTCCAACGTAGGCTATTGCGGGGCTGAATGGGATGCAGCTGGGTGACAAGAAACTGCTGGTCCAGAGGGCGAGTGTGGGAGCCAAGAATGCCACGCTGAGCACCATCAACCAGACCCCTGTGACCCTGCAAGTGCCCGGCTTGATGAGCTCCCAGGTGCAGATGGGTGGCCACCCGACCGAGGTCCTGTGCCTCATGAACATGGTGCTGCCTGAGGAGCTGCTGGACGACGAGGAGTATGAGGAGATCGTGGAGGACGTGCGTGATGAGTGCAGCAAGTATGGGCTGGTCAAGTCCATTGAGATCCCCCGGCCCGTGGATGGTGTCGAGGTGCCCGGCTGTGGAAAGATCTTCGTGGAGTTCACCTCTGTGTTTGACTGCCAGAAAGCCATGCAGGGCCTGACGGGTCGCAAGTTCGCCAACAGAGTGGTTGTCACAAAATACTGTGACCCCGACTCTTACCACCGCAGGGACTTCTGGTAGAGGCGGTGGGGGAGGGTGGGGCCGGGCTGGCGTAGGGCTTCTGCCCTGCCACCCCCCCTTTTTCCCCCTCTGAAGACATGGGCAGAGGAGTGACAGCCGAGTGACAGCCGGCAGCAACTGGAATGGCAGCAATTTAAG