Transcript asmbl_40582

Sequence
Transcript Sequence for observation asmbl_40582 of TGE0005438:
GCAGACTTGCCAGTGCCCCAGGTGAACGAGCAGAGGGACCTGGACCCCGGTCGGATGCAGATGCTGCAGGGGAACCCGCTGCTGCTCCCACACAGCCTGCAGGAGCTGCTGGCCAAGGACACCGTGCAAGTGGCCCTCGTCCCCGAGAGGAAGGGCCTCTTCCTGAAGCATGTGGAGTACGAAGTGTCCAGCCAGCGCTTCGGGGCCTCCGTGAGCCGCCGGTACAACGACTTCGTGGTTTTCCACGACCTGCTGCTCCAGAAGTTCCCCTACCGCATGGTGCCGGCCCTGCCGCCCAAGAAGATGCTGGGAGCTGACAGGGAGTTCATCGAAGCCCGGAGGAGAGCCCTGAAGCGCTTCATTAACCTGGTGGCCCGGCACCCCCCCTTCTCCGAGGACGTGGTGCTCAAGCTGTTCCTGTCCTTCAGCGGCCCCGACGTGCAGAGCAAGCTAAAGGAATCGGCTCAGTGTATGGGAGACGAATTCACGAACTGTAAGCTGGCGACGCGGGCCAAGGACTTCCTCCCAGCTGACATCCAGACTCAGTTCGCAGTTAGCCGGGAGCTGATCCGAAATGTCTACAACAGCTTTTACAAGCTTCGTGATCGGGCCGAGAGGATTGCGTCAAGGGCCATCGACAATGCTGCTGACCTCCTCATATTCGGGAAGGAGCTAAGTGCTTTAGGGTCTGACACGACACCGCTCCCCTCCTGGGCCGCTCTGCACAGCAGCACGTGGGGGTCCCTCAAACAGGCGCTGAAAGGGCTCTCTGTTGAGTTTGCACTGCTCGCTGACAAGGCCGCCCAGCAGGGCAAAAAGGAAGAGAACGATGTGGTGGAGAAGTTGAACCTCTTCCTGGATCTGCTCCAGTCCTACAAGGTGAGTCTGGGCAGCTCCCGCTCAGGTCCCGTGAGCTTTCAGGGCTGTGG