Transcript asmbl_40580

Sequence
Transcript Sequence for observation asmbl_40580 of TGE0005438:
GCAGACTTGCCAGTGCCCCAGGTGAACGAGCAGAGGGACCTGGACCCCGGTCGGATGCAGATGCTGCAGGGGAACCCGCTGCTGCTCCCACACAGCCTGCAGGAGCTGCTGGCCAAGGACACCGTGCAAGTGGCCCTCGTCCCCGAGAGGAAGGGCCTCTTCCTGAAGCATGTGGAGTACGAAGTGTCCAGCCAGCGCTTCGGGGCCTCCGTGAGCCGCCGGTACAACGACTTCGTGGTTTTCCACGACCTGCTGCTCCAGAAGTTCCCCTACCGCATGGTGCCGGCCCTGCCGCCCAAGAAGATGCTGGGAGCTGACAGGGAGTTCATCGAAGCCCGGAGGAGAGCCCTGAAGCGCTTCATTAACCTGGTGGCCCGGCACCCCCCCTTCTCCGAGGACGTGGTGCTCAAGCTGTTCCTGTCCTTCAGCGGCCCCGTGAGTACCTCAGGGACAGGCAGCCCCACTGCTCTGGGCCATGCTGGAGTCTGCAGATGTAGAGCGTGGCCCCAGGTGACGCTGTGCCCCTGGGGACGTGAGCTGAGCTGGAGGCACGCAAGTCCCGAGAAACGCACTCTGCACCACGTCAGTGTCAGAAGCCCAAGCGCCAGTGTCCTCCACACTGCGGTCCCGCAGTTGAGATGAGTCAGGAAGCCAAGGAGCTGCTCCCAGTCGGGGAGGAAGACTTCATGGCAGGCCGCCTCGTCCCCAGGGCTGTCACCTGTTCTGTAGGAAGGGACCTTCTCACTGGGGCGGGGTGAGGGAGCTCCGATGGGGTCGATGCGTTCGGTCCCCACCGTTAGAGAGGACCCCTTCTTGTGCAGGCACCTGGGAAGGGGCTCGGCCTGGGGTCAGCGTGGCAGAGGTGGCAGTGGCTGGGACCCTGGACCGGGCCTCAGGCTCTCCCACTGTGATCCCAGGGGACGGCGGGTGCTGCCCCT