Transcript asmbl_40578

Sequence
Transcript Sequence for observation asmbl_40578 of TGE0005438:
GCAGACTTGCCAGTGCCCCAGGTGAACGAGCAGAGGGACCTGGACCCCGGTCGGATGCAGATGCTGCAGGGGAACCCGCTGCTGCTCCCACACAGCCTGCAGGAGCTGCTGGCCAAGGACACCGTGCAAGTGGCCCTCGTCCCCGAGAGGAAGGGCCTCTTCCTGAAGCATGTGGAGTACGAAGTGTCCAGCCAGCGCTTCGGGGCCTCCGTGAGCCGCCGGTACAACGACTTCGTGGTTTTCCACGACCTGCTGCTCCAGAAGTTCCCCTACCGCATGGTGCCGGCCCTGCCGCCCAAGAAGATGCTGGGAGCTGACAGGGAGTTCATCGAAGCCCGGAGGAGAGCCCTGAAGCGCTTCATTAACCTGGTGGCCCGGCACCCCCCCTTCTCCGAGGACGTGGTGCTCAAGCTGTTCCTGTCCTTCAGCGGCCCCGACGTGCAGAGCAAGCTAAAGGAATCGGCTCAGTGTATGGGAGACGAATTCACGAACTGTAAGCTGGCGACGCGGGCCAAGGACTTCCTCCCAGCTGACATCCAGACTCAGTTCGCAGTTAGCCGGGAGCTGATCCGAAATGTCTACAACAGCTTTTACAAGCTTCGTGATCGGGCCGAGAGGATTGCGTCAAGGGCCATCGACAATGCTGCTGACCTCCTCATATTCGGGAAGGAGCTAAGTGCTTTAGGGTCTGACACGACACCGCTCCCCTCCTGGGCCGCTCTGCACAGCAGCACGTGGGGGTCCCTCAAACAGGCGCTGAAAGGGCTCTCTGTTGAGTTTGCACTGCTCGCTGACAAGGCCGCCCAGCAGGGCAAAAAGGAAGAGAACGATGTGGTGGAGAAGTTGAACCTCTTCCTGGATCTGCTCCAGTCCTACAAGGACCTGTGCGAGCGGCACGAGAAGGGCGTGCTGCACAAGCACCAGCGGGCGCTGCACAAGTACAGCCTGATGCGGAGGCAGATGAGCGCGGCCGTGCACGGCCAGCAGCCCGAGGCCGTGCAGCAGCTGGAGTCGCGCATCGTGGAGCAGGAGAGCACGATCCAGACGATGGAGCTGCGGCACGCCTTCTCCCTGTACTGCCTGCACCAGGAGACGCAGCTGGTCCACGCCCACCTGCCCCTCACCTCCCACATCCTCGGGGCCTTCGTCAACTCCCAGATCCAAGGGCACAAGGAGATGAGCAAGGTGTGGGACGACCTGAAGCCCAAGCTGCACTGCCTCTTCGCTGGACCCAACAGCACCTGACCCTGCCAGGGTCCCCAGGGATGGCCTGTCTCCTCACTAGTGCTGCGAGGACCCGGGGCGCAAAACCCACCGGCGCCCTCACTAAAACTTCTTTCCAAACGGTGTGTCCCTGTTTGATTCCCTTCAGAGAGCAGCTGTCCCCCATGTCCCGCGGGCTGCCGCCCTCAAGCAGGAGAGCTGACGTCAGGGCTGGCAGGTCCGGTGCGACGGCGCAGAGCCGAGGACACGGCTGTGGGCTCAGGCTGTGGCCGTCCTGGCCCAGCGCTGTGGCCTGAGGCTTGTGCTGGAAAGCGTCGGCCCCTGGGATGGCTTCCCCTGGGACCTGGAGGCCAGCGTGCGGCAGAGGTTTTCACAGCACACGGTGCCCGGGGGGTGCAGGGGCCCTGTGCTGGAGCAGCCGGAGAGGGAGGCCGAAACCCTGTGGAGGGCAGGAATGTCCCTGCGGTGGCATGTCACCCTGGATGAGGCACAACTGATGAGTGAGAGGGCAGTCCTGGGCGGGGGGTGAGTGTGCGAGGCGGCTGCTGGGGCCAGCAGGGCAGGTGCAGCTGGGGGCCGCTGGGCATGAGCGTTTCGCTTCCACAGAATGAGCTCCCGCGAGCGTCTCGTGTCCCTACACATGCGTGTGCATGTGCACACACTCTGTGACCCAGGTGTGCCCGTGGTCTGAGGTGTGGCAGACAGGGTGGCCTGGTGCTTCCGCTGTCCGTCCCTGTACCAGGAGCTGCTGTCCTCCCTGGAGAGATGCTCCTCTCTTTTGGGGCTTAGAGGGGGCCGTGGGGGAGTTGTTCTGCCTGGGGCCTCTCAAACTGCCTCATTCCCGGTTGACTAGAACCCTCCTCCCAGCCTCTCTCGCACTTGCTGGCCCAGCCACCTGTGCCCAGGGGCCTGGCATTGCGGCAGCTCTGGGCGTGGGAAAGGGTGTTTCCTGCTCTGAGTCCCGTCCGTGTGAACGTGGAGCAGACTGGCCCCCTCGGGCGCCCTGGCCCTTACTGTCTCGTTGGCCAGGAGAGGTGTCGGAGGCGGCTCTGACTCAGAGCTTTCTCTGTCAGATGTGGAGTCTGCCTTCTATTCGCCCACCCTCACGGGCATGCAGGACCCGGGATGGAGCTGGAGGCTCTGGGTAACTGCGCCTGCAGATGGGTGCCGCACTTCATGTCCCGGGGGAGGTGTGTCGGGCCCGCCCGCGTGATTCCACCCGTGTGGAAGCAGCCGTGGGTGTGGGCAGGCCAGCTGTGCTGCCCCAGCCGAGGCGCTGCCGGGCCGACGTGTGCCTCCCGGGCTGAGGAGCACGCCTGTGCTACTCCACGGGGCTGGTCCTTCCCAGTGCTGTGCACTTGAGCCATAAAGCGTGTCCTTCAGTGGCTGCTGCTCACCTTCTGGAGCCTGTCATGCGTGGCAAGGGGCAAGCCACCACCAGAGGGGGAAGTAGTCCACACCCCAACCAGATGGGCTGGATGGCCGGATCGGGGCACAGCTCGCACACTGGGGCAGCAGTGTGGGAGGGTGACAGGGAGTGGCTCCCAGTCAGGTTGAGGCCCTCCTTACCAGGTCACTGGAGAGTTTCAGCACCAAAGACGTCCTCCTGATGGCCTCTGCTGCTGGCACACCACCCTGCCGGGAGCCAAGGAGCAGGCTCCTGGCTGGGGCCCGGGCCCTGTTATTGGAGGCTCCCCCAGAGGGGCACTTTCATCCTGGGCGCTGTGGAGGTCTAAGGGAGGACACTCAGGAGTGACAGAAGGTCATGTCAGCTGGGGACAGCAGAGGCCACCTTTTTCCACAGTTTCCTCTTGGCCCGGAGCCTGGGCTGCTGGTAGATTCCTGGCTGGGGGCTGGCATTCTCTGCTTTGTCCTGGGGAGGGCGTGGAGGCCACTGCCAGCCGTGGGTAGAGGCTCGGGGTGGTGGGAGGGCAGGGGTCTCCTGCACGCCTCCACCGTTCCTGCCGCCCGCACTGTCCTTGCCAGCCAGGGAGAGCCGATGTGCCACTACAGCCTCGCCTCACCTGGCGGAAGGACCCCCACTGTGCTACCGACGGGAGCCCTGCCCCAGGGACGCTGGAGTGAGGCGGCCTGCGCCCAGCTCACCCACTGGGGACTGGAGACACGCCCTAGGCATTGGGCTGAAGACAAGGTCTGGGTAGCCTCTGTGAGGACAGTTCTGTGTGATGCCCTCCCTCTTGCTCTGCGTGAGTCCAGTTTTCCATGTGAAACGCTGCATCAGGCTGCGGGACTCAATCACCACCCCTCCGATAAACTGGAGCTCTCTACACGTGGTCTACACATTCCACGACTTTCATCCACAAACTGACAAACTATTAAACATGCT