Transcript asmbl_40518

Sequence
Transcript Sequence for observation asmbl_40518 of TGE0005420:
TCAGTGCTTCTCGGCCGTGGATGAAGAACAAGAAGCTGCTGCTCCTGGCTGTGTCCGAGTTGTGGCGGTGGCGGTGGCGTGCGGCCGGCGTGGGTGCGTGGCAGGCTGGCCGCAGCAGGGGACGTGTCTGCACTTCTAACCTCTGCCTCCCCGCATTGCTTCTCCTCCTGCAGTATGATTTGACGTCGCGAACATGGACTTTTCTCGGCTCCACATGTACACGCCGCCGCAGTGTGTGCCCGAGAACACTGGCTACACATACGCACTCAGTTCAAGCTATTCTTCCGATGCTCTGGACTTCGAGACTGAGCACAAGTTGGATCCCGTGTTTGATTCTCCAAGAATGTCCCGCCGTAGTTTGCGCCTGGTCACCACAGCGTACACCACCGATGGTGGCCAGGCTGGGGACATTCACTCCTGCGACAGCAGCATGGCCTCCCTGAAGGACAGAGCGGCCAGAGCAGCAAAGCAGCGCAGAGGCGCAGGGAAGCTGGCCTGGAGCGTGAACCACACGTCCGGAAAGGTCGCGGCTGGCCTGCAAGGTGCCGCTGGTCTGCGGCCTCCCGTGCTAGATGCGTCCCTGATCCGCGAGCAGACCAGAGTGGACCACTTCTGGGGTCTTGACGATGACGGAGATGTGAAAGGTGGAAGTAAGGCTGTCACTCAGGGAAATGGCGACGTGGCGGCGGACGCGGCCAGGAGCAACGGCTACACCTGCAGTGACTGCAGCCTGCTGTCCGAGCGCAGGAACACGCTCACCGCGTGCTCTGCCTCCCAGGGGACAGTGTCGCGGATCTACTCGAGGGACAGGAACCAAAAACGCGGCGCGTCTTTCTACACGGATAGGATTTTGTGGCTGGCCAAGTACGTTTCGTCATCTCTTTCATCATTGTTAGTTCAACTTTTTCAAGTGGTTTTAATGAAGCTCAATCGCGAATCAGAAAATTACAAATTGAAAAGTTACGAATCAAAAGATCGTGAATCAGAAAGCTATAACTCAAAAAGCCGTGAATCAAAAGCTCGGCCTGGCGACAGAGGGAGGATGGACGTGAAAGGCGTCCTCGGAGAGGACGGCCACCTCAGGGAGAATGGGGAGTCGTCGTGCGATGACTGTAAGGGGAAGCAGCGCCTTGAGACACAGCCAGCCAGCCACTGGCAGTCTTCCGGGCCATGGAGCGTGGCAGGGACCGTTGGGCACACCTTTTCTCAAGCAGGTCGCTTCTTGACGCAGACCCTGCAGAGGACCCGAGCGGCAGGGTGGTTTGTGTCGGAGACGGTGTTGTCGGTTCTTTGGTTGGCCATGGTGGCTCCAGGGAAGGCAGCCTCTGGAATATTCTGGTGGCTGGGGAGTGGCTGGTACCAGTTTGTTACTTTGATTTCTTGGCTGAATGTGTTTCTTCTTACAAGGTGCCTTCGAAATATTTGCAAGCTTTTAATCTTGCTCATTCCACTGCTGCTTTTACTGGGTGCAGGCCTTTCACTCTGGGGCCAGGGCGGTCCCCTGTCGTTCCTGCCCGCGGTGAACTGGACACACGTGTACAGAGCGCAGAGGGCGGACGGCCCCGGGAGCACCTTCTCGCCTGACGGTCCCCGCCCGAGCCCACCCCTCGAGGCTGGTGATGGGACCGTTGGCTGGCGTCGGATGGGTGAAGTGGAAAGGTGGATGACGTCTTTGTCTGGACAGTGCCAGAGCCACGATGAGCGGCTCAGAGACTTGACAGCCTCGCTTCAGAAGCTGCAGATGCGCGTGGACCAGATGGACGGCGGCAGGGAGGGGGTGTCGTCCTTGGTGAGCCACGTGGTGAGCCAGCGTTTGAAGGAGATGAGTGCCGACGGACTCTTGGGCCCCAAGGCTGACCACGTGACCGCCCACCAAGACCATGGCGCACGCATCGCAAACCTGGAAGATGTTCTCGGAAAACTGACAGAAAAGTCTGAGGTCATCCAGAAGGAGCTAGAACAGACCAAGCAAAGGACAATGAGCGGGCTCGAGGAAGAGCAGCGCCTCCTGTCGGTGGTGAAGCAGCTGCAGCTGGAGCTGAGTCTCCTGAAATCAGAGCTGTCGCAGGGGCAGCATGTGACCCCCAGCTGCGAGCAGGGGGATGCCATCCACGAAAAGGTGGACGCCCGGGTCAGGGAGACGCTCGGGCTCCTGGTGTCGGACGGGCAGTGGGCCGGCGTGCTGGAAGGGCTGCTCCAGAAGCTGTCTTCGCAGTTTGTCGGCAAGGACGACTTACAGGTGTTGTTACGAGACTTGGAGCTGCGGATACTGAAGGAGGTGACCCACCGTGTTTCCGTGACAAAGCAGATCCCCACGTCTGAAACGATCATGTCTGCTGTGAACGACGCCGGGGTTTCTGGAATAACAGAAGCGCAAGCGCACGTCATTGTGAACAATGCATTGAAGCTCTATTCCCAGGACAAGACCGGCATGGTGGACTTTGCTCTGGAGTCCGGCGGCGGCAGCGTCCTGAGCACCCGCTGCTCCGAGACCTACGAGACCAGGACCGCGCTCGTCAGCCTGTTCGGGGTGCCGCTCTGGTACTTCTCCCAGTCGCCCCGCGTCGTGATCCAGCCTGACATGTACCCGGGGAATTGCTGGGCGTTCAGAGGCTCCCAGGGGTACCTGGTGGTGAGGCTGTCCATGAAGATCCACCCAACCAGCTTCGCCCTGGAGCACATCCCAAAGGCACTGTCGCCCACCGGCAACATCAGCAGCGCCCCCAAGGACTTCGCGGTCTACGGACTGGAAAATGAATACGAGGAAGAAGGGGAGCTGCTGGGCCAGTTTGTGTACGATCAGGAAGGGGAGTCGCTCCAGATGTTCCATGCTCCGAAAAGACCCGAACGAGCTTTCCAAATCGTGGAGCTTCGGGTTCTGTCCAACTGGGGCCATCCCGAGTACACGTGTCTCTACCGGTTCAGAGTCCACGGGGAGCCTATCAAGTAGGCCTCTCCTCGCTCCTCTTGTACATTCTGTATATACTGGGACAGCCCGAAACACTGGATCCTCCCTGAACGAGGCGTAGGACGGACAGCATGACGTCGTCTGTTAAATAAACGTTACTGACCGCCAGCAGCAGGACTGGGGATTGAAGCGGCGACGCCGTGCGCCCAGCTGGCCGTTGTGTCCGCGGGAAACACTGCATGTTGAGTGCTCGGGTTTACGGGGGCCGCTGGCAGCGGTGGCTTCGGAAATGCATTTGAATGTATGGTTCGCAAAGACACTTAACTTCGTTTTGGGGATTTGTTTTTAAACATAAAGCTCTTTATACCTGTCTTTCCTTGACGTCAGGAGCAAAGCAAATGAAGTTGAAAGGTTTGAAGTGTTCTCGAAACTTTCACCGGCCCTTTTAAAGGACTTTGAGGGGGTCGGGGGCGGGGGTTACCTTTTCAGTCCAGCATACGTATCTTTCAGGGAGAAACAATGTCACCAAGTTTCAGGGTTCCAAGCTCCTTTCCTTTAGGGTGGGGGTTTTCTTTTATTCAGTACCACTAGTTATTTTAAGTTGCCAGGTGGGGAAACGCCTAAAATGTGTTCTTCTGCTCAGTTTGCTCTACTTCTGAGAAAGATTTGCAAGGTCAGGGCTCAGCGTGCCGCTCTCCATGCGGGACCACGGGGGAGTTCGGTTTCGTTTCATTGCGGGTTGCAGTGGTTCTGACTGGAAGGGGGACAGTCCGGATCCAGACCCCGAGAAAGAGCTCTCAGGTCCGCCAGGCTCATCCCGTTGGGATCGCCCCGGAGTGTCCACTTCACAGCTCGAGTGGGAACTGAGGAATCCAACGGTTGGGTGTTTTCAGGTTGTCTTTTGAATTTGGCTGAAAAGCGAACACTAACGTGCTCCGGATCTCTCAGAGGCTCATGTTTTGAATCCACTGATGCGCTTATCAAAGGGGGACTGGTCAGTGCGGCGAATTCATAGAACCGTTAGGTCTCGTGACCATGACTTTCCTCACAGTGGCACTTTCTACTGGCTCTGGTGGGGATTTGCCTCTTAGGACGACCGTCAACCATTCTCCCTCAAGTCCTGCGAGTCTCATTTAGGTTATAATTAATATTTCATACTGAGACTGTTATACTGAGCAGACTTTATAAATGAGATGTCCACAAGGCACTTAAAGTGTTACAGATGTTTTACCTTAAAATTATTTAAGTTTTATTGGGTTAAGACAGTTTCTTGGTGTACCATAAATCCTGTATTTTTCAGAAAAAAAGATAAAATGATGGTGCTGACTGGTTTTCTGAAGAGTTTTATGTAAATTGCACAACAGTCCTCAAACATACAAAAACTACATAACAGAAAGTAGCATTTTTTCACTTACAATCAGAACTAATGCCTATGCAGTTAAGTTGGATACAATGTACACAGATGTTTCATATATTACGGGATAAATATATAAATCAAAATTTCCTATATTAAACAGTTGGGGAGTTGGGGTGGAAATATTTTGAATATTAATTTATTTTTAAAGATGCAAGATAGGACTTTGTGCAATGTATTTTTGTAAATGCTTTTCAAAATATTTGTCTTTGGTAGTCTTTCTTTTGCTGCCACCAAATTGATAAGATGCTATTGAAATGTTTAAATAAAGAGTTTTAATTTTTAAAAGTGCATGTGAAATTTCAAATGGATAATAAACAGTATATTTCTTTTCTC