Transcript asmbl_40389

Sequence
Transcript Sequence for observation asmbl_40389 of TGE0016034:
GGCGGACGGACGGACCGCGGCGCTGGCCCGCTGAGCTAGTTCCTGCTGGGTCTGGGTCGCCGTCGCCGCCCGGGTCCTGTCGCCTGATGGTCCGCCTGTGAGGCGGGCTGCCGGCTGACGTCTCCTCGCGATGGAGCACATCCGTACGACCAAGGTTGAGCAAGTGAAATTACTTGACCGATTCAGTACCAGCAACAAGTCATTGACAGGGACACTGTATCTTACAGCCACACACCTGTTATTTATAGACTCTCATCAGAAGGAAACCTGGATTTTGCACCATCATATTGCCTCAGTAGAGAAACTGGCTCTGACGACTTCTGGGTGCCCACTTGTGATTCAGTGCAAGAACTTCAGGATTGTGCATTTCATTGTTCCCAGAGAAAGAGATTGCCATGACATTTACAACTCTTTGCTACAACTGTCAAAACAAGCAAAATATGAAGATCTCTACGCATTCTCTTATAATCCCAAACAAAACGATTCAGAACGACTGCAAGGCTGGCAGCTCATTGACCTCGCTAAGGAATACGAGAGGATGGGAGTGCCAAATTCAAACTGGCAGCTGTCGGATGCCAACCGAGAGTACAAGATTTGTGAAACTTATCCCAGAGAACTCTATGTTCCTCGAATAGCAAGCAAGCCAATCATCGTGGGCAGTTCCAAGTTCCGGAGCAAGGGGAGGTTCCCGGTGCTTTGCTACTATCATCAGCATAAGGAGGCTGCCATTTGTCGGTGTAGTCAGCCACTGTCAGGATTCAGTGCCCGGTGCCTGGAGGACGAACATTTGCTTCAAGCCATTAGTAAGGCCAACCCGGTCAACCGCTACATGTACGTCGTGGATACCAGGCCCAAACTGAATGCAATGGCCAACAGAGCAGCTGGAAAAGGTTATGAAAATGAAGATAACTATTCTAATATTAGATTTCAGTTTGTTGGAATTGAAAATATTCATGTCATGCGGTCCAGCCTTCAGAAATTATTGGAAGTCAGTGGTACCAAAGGGCTTTCTGTCAATGATTTCTACTCCGGTTTGGAGAGCTCGGGTTGGCTTCGCCACATCAAAGCTGTAATGGACGCTGCAATCTTCTTAGCCAAAGCAATAATGGTTGAAAATGCTAGTGTGTTGGTGCATTGTTCTGATGGCTGGGATAGGACTTCCCAGGTGTGTTCCCTCGGCTCCCTGTTATTGGATTCCTACTACAGGACGGTCAAAGGATTCATGGTCTTAATAGAAAAGGATTGGATCTCCTTTGGACATAAATTTTCAGAGCGGTGTGGCCATTTGGATGGTGACCCAAAGGAAGTCTCACCGGTGTTTACTCAGTTCTTGGAATGTGTGTGGCATTTGACCGAGCAATTTCCACAAGCCTTTGAATTCAACGAAGCGTTTCTTCTTCAGATCCATGAACACATTCATTCGTGCCAATTCGGAAACTTCCTTGGAAATTGTCAGAAGGAAAGAGAAGAACTCAAGTAAGACGGTTTGATTAAATGGGCTCTTTTTTTCCCTACTTAAGTGAGGTCTGAC