Transcript asmbl_39940

Sequence
Transcript Sequence for observation asmbl_39940 of TGE0005387:
GTGGTGGGCATGATAGCGAACTTGGTAGGGTTGCACGCGGGTTCAAGTTGTTGTTGGGGTTCTTTTGTGCCAGGGGGCTCTACGAGCTTGGGGCCCCGTTACTACTTTGTCAGTGGGTGCAATGGCGCTTCTCCGGGGTATGTGGGGCGTGCTAAGTGCACTGGGAACGTCCGGAGCTGCTCTCTGCGCAGACTGTGGGAGTCGACTGCGCTCTCCCTTCAGTTTTGCGTATATACCGAGATGGTTTTCATCCGCCTTGATTAGTTATCCAAAGAAGCCTATGACTTCATATGTTCGATTTTCTAAAGAACAGCTACCCATTTTTAAAGCTCAGAACCCAGATGCGAAAAATTCAGAACTAATTAAAAAAATCGCCGAGCTATGGAGGGAACTTCCTGAGTCAGAAAAAAAAGTATATGAAGATGCTTATAAGGCAGACTGGCAGGCATACAAAGAGGAGATAAACAGAATTCAAGAACAGCTAACTCCAAGTCAGATGGTATCTTTGGAAAAAGAAATCATGCAAAAACGTTTAAAAAAGAAAGCAATAATAAAAAAGAGAGAGTTAACAATGCTTGGAAAACCGAAAAGACCTCGCTCAGCTTATAACATTTTTATATCTGAACGCTTCCAGGAAGCTAAGGATGGTACATCACAGTTAAAGCTGAAGACTGTAAATGAAAGCTGGAAAAATCTCTCTAGTTCTCAAAAGCAAGTATATATCCAACTTGCTGAAGATGATAAAATTCGTTATTATAATGAAATCAAATCTTGGGAAGAACAAATGGTTGAAGTTGGACGAATTGATCTTCTCCGTCGCAAAATGAAGCCCCAAGCAAAAAGCACTGAGAAGTGTTAAATAGAAGATTGAGTTATGTTCATAGTGGATAGATACAAGAAACCAATTAGGTCTCAATACCTGAAGCCGTTGTTAAATTAGAAAGGATAAAGTTGGTAAACATTTTATACTTAATTCCTTTTTCTTTAGCCCATGGACTTCTGCCAGTTCAATACATTTTGTATGAGTATCTTGCTTTGGAAAACCCAAACAGATAAAAAATTCACTTGAAATTTATTTTGCGTTTAGGAACTACTAAGGGTTAAAATAATCCATGAAATGTATCAATGATCATTTTACCTTTGATAAAGGTGAATCAGACTGTGAAGTTTTTTTATACTTGTTGACTGGGAAGAGTATTCTTGTTTCCTTATATTATGGAGGCAGGGGTTTCATATTCAAAAGTGTCCCAAATTGTAGAGCCATAATGTTCTGTGATATAATTGTGCATTGTTTAAAAGAGCACCAGGAACTCATCTAGGTAAATTCCAATTCCTAGGCATCATTCACATTATATTCAGATTTGGTGGTAATGCAAGGGATTGCTGGTTTCGGTTACAACTTTTTGTATAAAGGATAGAGAGATTTATAAACCTTTTTCTCATTGCCTTTTTTCATAAATTAAAAACTAAGAAATTATGTACCAAATCTATGCATATTTTATATTGCATAGAATACATTTTTT